Brain Advance Access originally published online on October 21, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Brain, Vol. 127, No. 1, 133-142, 2004
© 2004 Guarantors of Brain
doi: 10.1093/brain/awh009
Novel presenilin 1 mutation with profound neurofibrillary pathology in an indigenous Southern African family with early-onset Alzheimer’s disease
,3
1 Division of Neurology and
2 MRC Human Genetics Research Unit, Division of Human Genetics, Groote Schuur Hospital and University of Cape Town, Cape Town,
3 Neuropathology Unit, Department of Anatomical Pathology, University of Stellenbosch, Tygerberg, South Africa and
4 Institute for Ageing and Health, Newcastle General Hospital, Newcastle upon Tyne, UK
Deceased
Correspondence to: Professor R. N. Kalaria, Institute for Ageing and Health, Wolfson Unit, Newcastle General Hospital, Westgate Road, Newcastle upon Tyne NE4 6BE, UK E-mail: r.n.kalaria{at}ncl.ac.uk
 |
Summary |
|---|
 Top Summary IntroductionSubjects and methodsResultsDiscussionReferences |
|---|
Genetically determined Alzheimer’s disease (AD) is virtually unknown in Africa. We report clinicopathological findings and a presenilin 1 (PS1) mutation associated with early-onset AD in a large Xhosa family from Southern Africa. Twelve individuals spanning four generations were affected, four of whom underwent clinical and psychometric evaluation. Their phenotype was characterized by memory impairment beginning in the early part of the fifth decade, with progressive dementing illness lasting 6–7 years that did not appear to be modified by the presence of an apolipoprotein E (APOE)-
4 allele. Initial linkage-based analysis using known DNA markers suggested allele cosegregation with a locus on chromosome 14. Direct sequencing of the PS1 gene disclosed a novel I143M (ATT to ATG at nucleotide 677) mutation that lies in a cluster in the second transmembrane domain of the protein. Examination of the proband’s brain at autopsy revealed severe AD pathology characterized by neuronal loss, abundant ß amyloid (Aß) neuritic plaques (Aß42) and neurofibrillary degeneration extending into the brainstem. The phenotype of the I143M mutation was clearly associated with a high degree of neurofibrillary change compared with early-onset sporadic AD cases. Although sporadic cases of AD do exist in African populations, our study confirms the existence of early-onset familial AD among indigenous Southern Africans.
Key Words: Africa; Alzheimer’s disease; apolipoprotein E; neurofibrillary tangles; presenilin
Abbreviations: Aß = ß amyloid peptide; AD = Alzheimer’s disease; APOE = apolipoprotein E; APP = ß amyloid precursor protein; DECO = détérioration cognitive observée; MMSE = Mini-Mental State Examination; PS1 = presenilin1 gene
Received February 27, 2003. Revised July 22, 2003. Accepted July 30, 2003.
|
Introduction |
|---|
|
TopSummaryIntroductionSubjects and methodsResultsDiscussionReferences |
|---|
Early-onset familial Alzheimer’s disease (AD) accounts for less than 5% of all cases of AD in Western populations. It is transmitted in an autosomal dominant manner and thus far has been linked to pathogenic mutations in three genes. The first locus identified was that on chromosome 21 encoding the ß amyloid precursor protein (APP) (Goate et al., 1991
), but mutations in the APP gene only account for 
1% of early-onset familial AD (Hardy, 1997; Tanzi and Bertram, 2001). The chromosome 14 locus linked to early-onset familial AD encodes presenilin 1 (PS1) (Alzheimer’s Disease Collaborative Group, 1995; Sherrington et al., 1995). To date, close to 80 different mutations have been identified in the PS1 gene (www.alzforum.org/res/com/mut/pre/table1.asp). Chromosome 1 bears a third locus that harbours the presenilin 2 (PS2) gene, in which at least six mutations have been described (Levy-Lahad et al., 1995a; Rogaev et al., 1995). Although allelic variation encoding apolipoprotein E (APOE) influences age at onset in sporadic AD (Farrer et al., 1997), it does not appear to affect age at onset in PS1-linked familial AD (Van Broeckhoven et al., 1994; Levy-Lahad et al., 1995b).
Significant heterogeneity has been documented with PS1-linked familial AD, particularly in age at disease onset (Haltia et al., 1994; Lampe et al., 1994; Kennedy et al., 1995; Crook et al., 1998; Queralt et al., 2002). Comparing kindreds with known mutations may allow the opportunity to correlate the genotypes and phenotypes of mutations in similar clusters or even identical mutations. Such comparisons may assist in determining the influence of epigenetic factors or environmental influences, even in different populations.
This report describes an indigenous South African family of Xhosa origin with early-onset autosomal dominant PS1-linked familial AD. The prevalence of AD amongst indigenous Southern African or black populations is contentious and, to our knowledge, familial AD has not been reported in Africans. Previous studies estimate the prevalence of AD to be low (
1%) in some African populations (Hendrie et al., 1995; Farrag et al., 1998), although pathologically verifiable sporadic cases probably exist in sub-Saharan countries (Ogeng’o et al., 1996).
|
Subjects and methods |
|---|
|
TopSummaryIntroductionSubjects and methodsResultsDiscussionReferences |
|---|
The proband and family
The proband was first referred for diagnosis in 1997 at the age of 50. Out of five other affected family members of similar age, three were subsequently also evaluated with full clinical examination. In addition, six unaffected family members were personally interviewed. One older unaffected individual was interviewed by telephone and his clinical status was confirmed in conversation with his family practitioner. The pedigree of this large Xhosa family (Fig. 1) was established after several interviews. The age at onset was taken as the first time that different family members collectively considered the individual to be definitely affected, as judged by increased forgetfulness and difficulties in daily living activities.
|
Blood samples were collected from a total of 13 individuals, including four affected and nine unaffected members, for genetic analysis (Fig. 1). Informed consent was obtained from all the subjects, following the guidelines for ethical research approved by the Research Ethics Committee of the Faculty of Health Sciences, University of Cape Town.
Neuropsychological screening could only be completed in two subjects, IV-13 and IV-16. The other two affected subjects (IV-10 and IV-19) could not be fully tested due to the severity of their impairment (Fig. 1). A Xhosa translation (unpublished) of the détérioration cognitive observée (DECO), an informant questionnaire (Lenger et al., 1996), was administered to relatives to determine whether there was any decline in the subject’s everyday functioning over the past year. The DECO is a 19-item questionnaire with a three-point Likert Scale consisting of ‘better’ (2), ‘about the same’ (1) and ‘much worse’ (0). In addition, the Mini-Mental State Examination (MMSE) was performed on one subject.
Neuroimaging
Axial CT brain scans were performed on all four affected individuals at the time of clinical evaluation. The scan angle was tilted to optimize the view of the medial temporal lobes. Starting with a lateral tomogram, sections were taken passing through the front of the hard palate parallel with the orbitomeatal line. Subject IV-19 had a single MRI brain scan that only included axial and sagittal T1-weighted sequences. Single-photon emission computed tomography imaging was performed in subject IV-13 at the time of clinical evaluation.
Autopsy and histopathology
The proband died at age 50 years, 5 months after she presented in the clinic. The autopsy was performed at the Department of Anatomical Pathology, Tygerberg Hospital. Death was attributed to bronchopneumonia. The lungs showed some anthracosis, occasional focal scars and variable bronchopneumonia. The heart, spleen and the rest of the abdominal organs were unremarkable. The brain was removed in its entirety and immersion-fixed in buffered formalin for detailed evaluation. Paraffin-embedded tissue sections were cut and stained by conventional histopathological and immunocytochemical methods from the four cortical lobes, hippocampal formation, basal ganglia, cerebellum and brainstem. We also evaluated in parallel brain tissue from three sporadic AD cases of Caucasian origin and with relatively early-onset disease. Their ages at death were 58, 64 and 67 years. The specimens were obtained from the Newcastle Brain Tissue Resource centre at the MRC building, Newcastle General Hospital.
To confirm the patterns of AD pathology, we used polyclonal and monoclonal antibodies to the following ß amyloid (Aß) peptides: residues 8–17 (Aß; 6F3D; Dako, Denmark), 17–24 (4G8; Signet, MA, USA), 36–40 (Aß40; Ter 40; courtesy of H. Mori, Osaka, Japan) and 38–42 (Aß42; Ter 42; courtesy H. Mori). The distribution of APP was studied by immunostaining with the 22C11 antibody (Boehringer Mannheim, Germany). Neurofibrillary pathology, Lewy bodies and APOE-containing lesions were detected with antibodies to tau protein (AT8; Endogen, UK), 
-synuclein (Novacastra, UK), ubiquitin (Dako) and APOE (courtesy of H. Mori). Specificities of Aß end-terminal antibodies and other AD pathology-associated antibodies have been well established previously. Upon immunoblotting, the Aß antibodies recognized the expected band(s) of proteins in solubilized preparations of neocortical homogenates from sporadic AD subjects (Kalaria et al., 1996).
Linkage and mutation analysis
Genomic DNA was extracted from whole blood using standard methods. Linkage-based analysis was used to identify the suspected early-onset gene contributing to the disease. DNA was amplified by PCR to determine cosegregation of particular alleles with the following markers (Sherrington et al., 1995) on chromosomes 1 and 14: D1S459, D1S490, D1S479, D14S77, D14S53 and D14S43. Based upon evidence of shared alleles, the PS1 gene was amplified using intronic primers as described previously (Hutton et al., 1996). In the first attempt, exons 3–10 of PS1 were sequenced directly and analysed using an ABI 377 automated DNA sequencer (Perkin Elmer Applied Biosystems, UK). The colour-coded electropherograms were checked for nucleotide ambiguity by manual inspection as well as by display on Sequence Analysis version 3.1 and comparison with published sequences.
To confirm the suspected mutation, restriction digestion analysis of exon 6 of PS1 (ordering based on current database; Yasuda et al., 1999) was performed in a series of samples, including those of affected and unaffected family members. An allele-specific nested PCR was run on the original exon 6 products with the following primer sequences: forward 5' GCCATCATGATCAGTGCCAT 3'; reverse 5' CCAACCATGGGAAGAACAG 3'. The PCR conditions included 58°C for annealing and 30 s extension time for 35 cycles using the Hotstar PCR kit (Qiagen, UK). The expected PCR product of size 124 bp was subjected to restriction digest with NcoI endonuclease (New England Nuclear) at 37°C for 12 h. The products were then separated on a 20% Tris–boric acid–EDTA gel and detected by silver staining (Condie et al., 1993).
APOE genotyping of DNA extracted from blood or formalin-fixed brain tissue was performed essentially as described previously (Premkumar et al., 1996).
|
Results |
|---|
|
TopSummaryIntroductionSubjects and methodsResultsDiscussionReferences |
|---|
Clinical findings
The Xhosa form part of the Bantu (indigenous people of south and central Africa), who lived predominantly in the homelands of Ciskei and Transkei in Eastern Cape until 1994. The family was traced back five generations to the east coast of Southern Africa and started relocating further south in the last two generations. There was no history of consanguinity or Caucasian admixture in the preceding generations of this Xhosa family. We recorded 12 affected individuals spanning four generations (Fig. 1). The first known affected members (I-2 and II-1) were said to have died between 60 and 70 years of age, although this was an approximation as their dates of birth were unknown. The ages of affected individuals in generation III were best estimates as many of them were not literate. Of the four affected individuals examined in the fourth generation, two (IV-10 and IV-19) were smokers and had used alcohol excessively at times. None had used illicit drugs or other medications. Subject IV-10 had also suffered a head injury 1 year before symptom onset, with brief loss of consciousness followed by confusion, which persisted for a few hours. There was no other significant medical history in any of the subjects. Due to sociopolitical factors at the time, the family members received less than 4 years, in some cases, and a maximum of 7 years (average 5.2 years) of formal school education. The matriarch of the family was interviewed 4 years after all the family members were first seen and confirmed that unaffected members of similar age (i.e. in the fourth generation) to the affected members were still normal with respect to remembering and their daily activities. The mean (± SD) age of unaffected members (n = 7) in the fourth generation at the time of the interviews was 57.3 ± 3.5 years (Fig. 1).
In the third generation, the mean (n = 4) age at disease onset, based on estimates from family members, was 49 ± 3.37 years, with a mean disease duration of 6.33 ± 2.31 years, and death was at 56.67 ± 3.21 years. In the fourth generation the mean (n = 6) age at onset was 50 ± 4.98 years and the mean age at death for three members was 55.33 ± 5.51 years, after a disease duration of 7.33 ± 2.10 years. The remaining three are still alive 3, 8 and 12 years after onset of dementia (Fig. 1).
Table 1 provides a summary of the various neurological and psychiatric features in the four affected individuals. The disease onset was remarkably similar in all affected individuals. The first reported symptom in each case was memory impairment; the patient would first either forget to hide their money or forget where they had hidden it. Progressive memory impairment was characterized by difficulty in remembering the names of their own children and eventually being unable to recognize them. Loss of memory of such characteristics is considered unacceptable in African cultures (Kalaria et al., 1997). Later, spontaneous speech became limited and the subjects would wander and get lost in the neighbourhood. Eventually they were unable to perform any activities of daily living, became mute and were bedridden. Myoclonus was not present in any individual at the time of examination (disease duration 8 ± 2.45 years) and only the proband suffered one seizure in the last 5 months prior to death (disease duration 5.5 years). According to the informants, seizures did not appear to be a feature of the phenotype.
|
The proband (IV-19, Fig. 1) was right-handed. She presented at 50 years of age 5 years after onset, and was found to have profound dementia. She was unable to communicate or recognize her family members, and unable to perform simple tasks of daily living. She was uncooperative, irritable and displayed repetitive behaviour, using either objects in the close vicinity or repeatedly cleaning when given an object. At times she was aggressive and at other times exhibited inappropriate laughter. Spontaneous speech was occasional, with loss of coherence. She could not follow simple instructions or name everyday objects. She was easily distracted and did not consistently respond to her name. Her blood chemistry values were within normal limits. The patient was discharged to a nursing home and died 5 months later.
Patient IV-13 was examined 5 years after the onset of her memory disturbance. She was pleasant and cooperative but disorientated for time. She could remember her children’s names but not their ages. She showed grossly impaired visual and verbal learning and poor recognition memory. She repeatedly perseverated on a word-generation test. Naming, language and visuospatial skills were still intact. The DECO questionnaire completed by her sister revealed a score of 13/38, confirming severe dementia. Four years later she started wandering from home and is currently awaiting institutional placement.
Patient IV-16 was first examined 7 years after the onset of symptoms. She often repeated herself during the examination. Like her cousin (IV-13), she had difficulty remembering the number and names of her children. Memory and visuospatial skills were very poor but naming and language skills were still intact. The DECO questionnaire was 3/38. She was institutionalized 3 years later.
The fourth subject (IV-10) was also examined 7 years after first symptoms. Two years previously he had started wandering from home and experienced auditory hallucinations. In the preceding month he had been intermittently incontinent. He could not wash or dress but could still feed himself. The patient was restless and irritable but was orientated for self. His speech was sparse but intelligible. He could name simple objects presented to him in the clinic room. The MMSE score was 9/30. Routine laboratory investigations were normal apart from a reactive fluorescent treponemal antibody-absorbed test in the blood and CSF but negative venereal disease research laboratory (VDRL) test for neurosyphilis. The CSF was acellular but protein was slightly elevated (0.7 g/dl; normal = 0.45 g/dl). These findings were not interpreted to be due to neurosyphilis; however, a course of therapy was given. The patient deteriorated and died 2 years later.
Neuroimaging
In all affected subjects, head CT imaging showed generalized cerebral atrophy, most marked in the medial temporal lobes and tempoparietal regions, with ex-vacuodilatation of the lateral ventricles (not shown). The severity of cerebral atrophy paralleled the degree of cognitive dysfunction. Atrophy with ventricular dilatation was most marked in the proband and least in patient IV-13. However, the posterior fossa appeared normal in all the subjects. A T1-weighted MRI of the proband was of poor quality due to movement artefact but essentially showed the same features as the CT image, with marked cerebral atrophy most prominent in the medial temporal lobe.
Single-photon emission computed tomography in patient IV-13 showed markedly reduced cerebral perfusion in the left medial temporal region, right parietal region and both parieto-occipital regions (not shown).
Neuropathological findings
Gross examination of the brain of the proband (IV-19) confirmed atrophy of the temporal lobes and less marked atrophy in the frontal lobes. The total brain weight at autopsy was 1334 g. The vessels of the circle of Willis and the vertebrobasilar system only showed focal mild atheroma. Consistent with the CT, the lateral and third ventricles were moderately enlarged. The substantia nigra was only mildly depigmented.
Histopathological examination of the brain revealed areas of focal neuronal loss with marked astrogliosis. Silver staining revealed large numbers of neuritic plaques and neurofibrillary tangles, particularly in the inferiomedial temporal lobes (Fig. 2). Neuritic plaques were abundant in all cortical lobes (Fig. 2A, B), including the striate cortex at the occipital pole. The mean density of amyloid plaques was 41 per mm2 in the cortical lobes. This compared to 48, 15 and 47 plaques per mm2 in three sporadic AD cases, who died at 58, 64 and 67 years. Hippocampal pyramidal neurons showed widespread granulovacuolar degeneration with marked neuronal loss, spongiosis and astrogliosis. Numerous compact and diffuse plaques in the neocortical lobes and hippocampal formation were further revealed by antibodies to Aß42 peptide, although very few were evident with antibodies to the more soluble Aß40 peptide (Fig. 2C, D). Sections from the cerebellum also showed diffuse Aß42 deposits, predominantly in the molecular layer (Fig. 2E). Focal amyloid angiopathy was evident in several meningeal vessels, as revealed by antibodies to Aß peptides (Fig. 2E). Antibodies to amyloid associated proteins, such as ubiquitin and APOE, also characteristically stained the deposits, suggesting no apparent qualitative differences between the pattern of immunostaining in this case and in sporadic AD cases. The periventricular and deep white matter showed diffuse demyelination that was consistent with sporadic AD cases. However, patchy accumulation of APP immunoreactivity was evident in the deep white matter, indicating diffuse axonal pathology (not shown).
|
Neurofibrillary pathology was evident in the form of dystrophic neurites, neuropil threads and extracellular tangles in all cortical lobes, including the primary visual cortex. Such features were also invariably present in the basal ganglia, particularly in the putamen and both segments of the pallidum. The density of tangles was >50 per mm2 in the cortical lobes and hippocampus. This compared to 38, 29 and 22 cortical tangles per mm2 in the three sporadic AD cases. The severity in the proband readily accorded with Braak stage VI. Several neurons also contained intracellular tangles. These were strikingly apparent in the lateral geniculate (Fig. 2F). The brainstem contained widespread neurofibrillary pathology, including extracellular and intracellular globose tangles in the central tegmentum, colliculi and medullary nuclei, revealed by antibodies to tau (Fig. 2G, H). These brainstem regions also contained several neuritic plaques stained by Aß42 antiserum. The nigral nuclei showed patchy neuronal loss, spongiosis, astrocytosis and occasional tangles in pigmented neurons. Lewy bodies were generally absent in the neocortex, substantia nigra and locus coeruleus, but a few
-synuclein-positive neurons and punctate extracellular deposits were evident in the molecular layer of the hippocampus proper. We could not detect any Pick bodies or Pick cells. All these features were consistent with the diagnosis of severe AD according to the criteria of the Consortium to Establish a Registry for Alzheimer’s Disease (Mirra et al., 1991).
Genetic analysis
Initial linkage-based analysis had suggested the involvement of PS1 but not the presenilin 2 gene in the occurrence of disease. Thus there was no evidence of cosegregation with markers on chromosome 1. However, this was not true with co-inheritance of the chromosome 14 markers, which pointed to an association. We also ruled out the possibility of the AD in this family being linked to known APP gene mutations by direct sequencing of exons 16 and 17 of APP. We found no apparent sequence variation in any of the four affected subjects compared with all the unaffected siblings or cousins in the fourth generation.
Initial direct sequencing of the PS1 gene in the proband (IV-19) and an affected sibling (IV-16) revealed a novel ATT to ATG mutation at nucleotide 677 in exon 6 (Fig. 3A, B). This was predicted to lead to an isoleucine-to-methionine missense substitution at codon 143 (I143M) in the second transmembrane region of PS1. This mutation or other exon changes were not apparent in the seven unaffected siblings or cousins and one other disease-free member of the family from the third generation (Fig. 3).
|
To confirm this novel finding, we also evaluated restriction digests of allele-specific nested PCR-amplified products of exon 6. The mutation created a NcoI restriction enzyme site in the mutant allele. The NcoI digest resulted in 98- and 17-bp fragments from the original 115-bp amplicon in the affected individuals with this mutation but not in the unaffected members (Fig. 3C). In further analysis we confirmed that the mutation was not present in 100 chromosomes of the normal Xhosa control sample.
In an attempt to evaluate if APOE genotype status modulated the onset or symptoms of disease in the affected members, we also screened 11 individuals whose DNA was available subsequent to the exhaustive linkage and mutation analysis. The APOE genotype of the proband (IV-19) was determined to be 2/4 (Table 2). Interestingly, both affected and unaffected siblings carried one APOE 4 allele. The 4 allele frequency was calculated to be 50% in both groups. As expected, the 2 and 3 alleles were almost equally distributed in the two groups. There was no apparent relationship between the presence of the APOE 4 allele and age of onset or age at death in the affected individuals (Table 2).
|
|
Discussion |
|---|
|
TopSummaryIntroductionSubjects and methodsResultsDiscussionReferences |
|---|
The PS1 locus is linked to the most aggressive form of familial AD, with disease presentation as young as 30 years of age (Fox et al., 1997
; Houlden et al., 2001), and by 60 years almost 90% are affected (Rogaeva et al., 2001). Although there does not appear to be a clear correlation between specific mutations and age at onset, cases with PS1 mutations in codons preceding 200 appear to be on average 5 years younger than those above codon 200 (Mann et al., 2001). The I143M mutation described in this report is a novel mutation that is part of the cluster at the second transmembrane domain (Fraser et al., 2000). Two other families with mutations at codon 143 have been described: a Belgian family bearing the I143T mutation (Cruts et al., 1995) and an English family with relatively later onset bearing the I143F mutation (Rossor et al., 1996) (Table 3). Unlike in the English family, our study suggests complete penetrance of this mutation. A recent screening of the PS1 gene in 414 subjects revealed the I143T mutation in two sisters and a further, unrelated individual. Interestingly, both sisters exhibited a very early onset of disease (<35 years) but both had also inherited another PS1 mutation (I439V) in trans from their mother (Rogaeva et al., 2001)
|
Myoclonus may appear midway through the illness (Fox et al., 1997
) or at a very early age (Mayeux et al., 1985) in familial AD. Unlike many other families with PS1 mutations and the I143T family (Table 2), who had both myoclonus and epilepsy (Mann et al., 2001), our family did not have myoclonus as a feature. Seizures also frequently occur in young-onset familial AD (Frommelt et al., 1991; Lampe et al., 1994; Haltia et al., 1994; Fox et al., 1997; Janssen et al., 2001). The proband’s aggressive illness appeared to be associated with only one seizure, supporting the view that other influences may play a role in the phenotype. Spastic paraparesis associated with a number of different mutations (Crook et al., 1998; Houlden et al., 2000; Moretti et al., 2000; Rogaeva et al., 2001; O’Riordan et al., 2002) and ‘cotton wool’ plaques in the neocortex were also absent in this family.
Our South African family is from a socioeconomically disadvantaged community and the patients appear to have presented late in their disease. Due to limited schooling as well as cross-cultural screening difficulties, the DECO informant questionnaire was used instead of Western psychometric tests. However, this is comparable to the modified informant questionnaire on cognitive decline in the elderly (IQCODE) used previously in other African settings (Sayi et al., 1997). The MMSE has more stringent literacy requirements and was not reliable in all subjects. Some of the unaffected members often displayed low scores. The DECO, proposed as an alternative approach for dementia screening, did not show bias with respect to education (Ritchie and Fuhrer, 1992) or social class (O’Connor et al., 1989).
Although assessed at different times in their disease, the pattern of cognitive decline appeared similar in all affected subjects. Memory loss was the earliest signs of the illness. There was preservation of naming at a stage when other cognitive skills were profoundly affected (Fox et al., 1997). However, the rate of decline varied; two affected individuals had preserved naming and language skills 5 and 7 years after onset whereas the other two, who were severely demented, exhibited minimal speech with similar disease duration. The question arises whether non-genetic factors (Graves and Kukull, 1994) that reportedly influence sporadic AD, including a low level of education, a history of smoking, alcohol use and head trauma, could have resulted in the intrafamilial phenotypic variability evident in this family.
The polymorphism in the APOE gene increases susceptibility to the development of AD later in life, with an 4 allele dose-dependent effect (Farrer et al., 1997). Although APOE-4 may influence the age at onset in familial AD due to APP mutations (Levy-Lahad et al., 1995b), the same effect has not been shown in AD due to PS1 mutations (Van Broeckhoven et al., 1994). We did not find any evidence to suggest that the 4 allele modified the onset or aggressive course of the disease, although a high frequency of the allele was apparent in both the affected and unaffected individuals. This is consistent with the increased frequency (25%) of the APOE-4 allele among Bantu Africans (Kalaria et al., 1996) and no or weak association of the allele with dementia in Africans, African–Americans and Hispanics (Kalaria et al., 1997; Sayi et al., 1997; Tang et al., 1998).
The neuropathological findings in the brain of the proband were generally consistent with observations in other individuals bearing PS1 mutations (Mann et al., 2001). There was a marked preponderance of Aß42-type deposits (De Jonghe et al., 1999; Singleton et al., 2000), but also widespread and intense neurofibrillary degeneration. Although unclear in previous studies, this feature also extended to the brainstem structures, with evidence of marked neuronal dystrophy in both the superior and inferior colliculi. The degree of pathology, including the lack of severe cerebral amyloid angiopathy (Dermaut et al., 2001), in the proband was consistent with the type 1 histological pattern, consisting of many diffuse senile plaques in the frontal lobes (Mann et al., 2001), although the age at onset did not coincide.
The prevalence of AD amongst indigenous South African subjects is not known. Local neurologists and old-age psychiatrists rarely encounter it (de Villiers and Louw, 1996). There appears to be only a single previous preliminary report on pathologically confirmed AD, in two black South African women (Cole, 1977). Community-based studies in Ibadan, Nigeria (Hendrie et al., 1995) and Upper Assiut, Egypt (Farrag et al., 1998) also suggested that sporadic AD was uncommon, with a significantly lower prevalence amongst Nigerian Africans (1%) compared with African–Americans (6%) over the age of 65 years (Hendrie et al., 1995). The investigators of these studies reason that these groups have similar origins but they acknowledge an estimated 25% white European admixture in the existing genetic pool of African–Americans (Chakraborty et al., 1991). This may also apply to Caribbean Hispanic families (Athan et al., 2001). A follow-up report confirmed the prevalence results, with the age-standardized incidence rate of AD amongst the West African population at 1.15% compared with 2.52% amongst African–Americans (Hendrie et al., 2001). There was a weak association of the APOE-4 allele and a much lower prevalence of vascular disease, which could contribute to a lower incidence of AD in Africa (Hendrie et al., 2001). There may be several other reasons why AD is not seen in indigenous South Africans; a decade ago the elderly (>65 years) constituted 8.7% of the white South African population whereas only 3% of the black South African population were elderly (Prinsloo, 1991). Given that rural communities still have difficulties in accessing tertiary health care and that memory impairment may be accepted as part of normal ageing, patients do not readily interface with clinicians (de Villiers and Louw, 1996). The proband in this family was not brought to medical attention until she had reached an advanced state of dementia, when the caregivers found it increasingly difficult to provide care.
In summary, we report a large African family with PS1-linked early-onset AD. Most of the clinical and pathological features are in keeping with those previously described in Caucasians. Although as-yet unknown environmental influences cannot be discounted, the variability in the course of the disease evident in this Southern African family suggests other influences play a role.
|
Acknowledgements |
|---|
We are indebted to Dr Marc Combrink for referring the proband for clinical evaluation. We thank Cindy-Lee Cupido for the initial linkage analysis and Janet Slade for technical assistance and are grateful to Julie Hind and Linda Cawley for secretarial assistance. Our research programmes are supported by grants from the Medical Research Council (UK), the Alzheimer’s Research Trust (UK), the Alzheimer’s Association, USA (IIRG Award), the National Institutes of Health (NINDS), USA and EU Framework 5 project.
|
References |
|---|
|
TopSummaryIntroductionSubjects and methodsResultsDiscussionReferences |
|---|
Alzheimer’s Disease Collaborative Group. The structure of the presenilin 1 (S182) gene and identification of six novel mutations in early onset AD families. Nat Genet 1995; 11: 219–22.[CrossRef][Web of Science][Medline]
Athan ES, Williamson J, Ciappa A, Santana V, Romas SN, Lee JH, et al. A founder mutation in presenilin 1 causing early-onset Alzheimer disease in unrelated Caribbean Hispanic families. JAMA 2001; 286: 2257–63.
Chakraborty R, Kamboh MI, Ferrell RE. ‘Unique’ alleles in admixed populations: a strategy for determining ‘hereditary’ population differences of disease frequencies. Ethn Dis 1991; 1: 245–56.[Medline]
Cole G. Autopsy findings in mental patients. S Afr Med J 1977; 52: 534–6.[Web of Science][Medline]
Condie A, Eeles R, Borresen AL, Coles C, Cooper C, Prosser J. Detection of point mutations in the p53 gene: comparison of single-strand conformation polymorphism, constant denaturant gel electrophoresis, and hydroxylamine and osmium tetroxide techniques. Hum Mutat 1993; 2: 58–66.[CrossRef][Web of Science][Medline]
Crook R, Verkkoniemi A, Perez-Tur J, Mehta N, Baker M, Houlden H, et al. A variant of Alzheimer’s disease with spastic paraparesis and unusual plaques, due to deletion of exon 9 of presenilin 1. Nat Med 1998; 4: 452–5.[CrossRef][Web of Science][Medline]
Cruts M, Backhovens H, Wang SY, Van Gassen G, Theuns J, De Jonghe CD, et al. Molecular genetic analysis of familial early-onset Alzheimer’s disease linked to chromosome 14q24.3. Hum Mol Genet 1995; 4: 2363–71.
De Jonghe C, Cruts M, Rogaeva EA, Tysoe C, Singleton A, Vanderstichele H, et al. Aberrant splicing in the presenilin-1 intron 4 mutation causes presenile Alzheimer’s disease by increased Aß42 secretion. Hum Mol Genet 1999; 8: 1529–40.
de Villiers C, Louw SJ. Determining the prevalence of Alzheimer’s disease in elderly South Africans. [Editorial]. S Afr Med J 1996; 86: 135–6.[Web of Science][Medline]
Dermaut B, Kumar-Singh S, De Jonghe C, Cruts M, Lofgren A, Lubke U, et al. Cerebral amyloid angiopathy is a pathogenic lesion in Alzheimer’s disease due to a novel presenilin 1 mutation. Brain 2001; 124: 2383–92.
Farrag A, Farwiz HM, Khedr EH, Mahfouz RM, Omran SM. Prevalence of Alzheimer’s disease and other dementing disorders: Assiut-Upper Egypt study. Dement Geriatr Cogn Disord 1998; 9: 323–8.[CrossRef][Web of Science][Medline]
Farrer LA, Cupples LA, Haines JL, Hyman B, Kukull WA, Mayeux R, et al. Effects of age, sex, and ethnicity on the association between apolipoprotein E genotype and Alzheimer disease: a meta-analysis. JAMA 1997; 278: 1349–56.
Fox NC, Kennedy AM, Harvey RJ, Lantos PL, Roques PK, Collinge J, et al. Clinicopathological features of familial Alzheimer’s disease associated with the M139V mutation in the presenilin 1 gene. Brain 1997; 120: 491–501.
Fraser PE, Yang D-S, Yu G, Levesque L, Nishimura M, Arawaka S, et al. Presenilin structure, function and role in Alzheimer disease. Biochim Biophys Acta 2000; 1502: 1–15.[Medline]
Frommelt P, Schnabel R, Kuhne W, Nee LE, Polinsky RJ. Familial Alzheimer’s disease: a large multigeneration German kindred. Alzheimer Dis Assoc Disord 1991; 5: 36–43.[CrossRef][Web of Science][Medline]
Goate A, Chartier-Harlin M-C, Mullan M, Brown J, Crawford F, Fidani L, et al. Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer’s disease. Nature 1991; 349: 704–6.[CrossRef][Medline]
Graves AB, Kukull WA. The epidemiology of dementia. In: Morris JC, editor The handbook of dementing illnesses. New York: Marcel Dekker; 1994. p. 23–69.
Haltia M, Viitanen M, Sulkava R, Ala-Hurula V, Poyhonen M, Goldfarb L, et al. Chromosome 14-encoded Alzheimer’s disease: genetic and clinicopathological description. Ann Neurol 1994; 36: 362–7.[CrossRef][Web of Science][Medline]
Hardy J. Amyloid, the presenilins and Alzheimer’s disease. Trends Neurosci 1997; 20: 154–59.[CrossRef][Web of Science][Medline]
Hendrie HC, Osuntokun BO, Hall KS, Ogunniyi AO, Hui SL, Unverzagt FW, et al. Prevalence of Alzheimer’s disease and dementia in two communities: Nigerian Africans and African Americans. Am J Psychiatry 1995; 152: 1485–92.
Hendrie HC, Ogunniyi AO, Hall KS, Baiyewu O, Unverzagt FW, Gureje O, et al. Incidence of dementia and Alzheimer’s disease in 2 communities. Yoruba residing in Ibadan, Nigeria, and African–Americans residing in Indianapolis, Indiana. JAMA 2001; 285: 739–47.
Houlden H, Baker M, McGowan E, Lewis P, Hutton M, Crook R, et al. Variant Alzheimer’s disease with spastic paraparesis and cotton wool plaques is caused by PS-1 mutations that lead to exceptionally high amyloid-beta concentrations. Ann Neurol 2000; 48: 806–8.[CrossRef][Web of Science][Medline]
Houlden H, Crook R, Dolan RJ, McLaughlin J, Revesz T, Hardy J. A novel presenilin mutation (M233V) causing very early onset Alzheimer’s disease with Lewy bodies. Neurosci Lett 2001; 313: 93–5.[CrossRef][Web of Science][Medline]
Hutton M, Busfield F, Wragg M, Crook R, Perez-Tur J, Clark RF, et al. Complete analysis of the presenilin 1 gene in early onset Alzheimer’s disease. Neuroreport 1996; 7: 801–5.[Web of Science][Medline]
Janssen JC, Lantos PL, Fox NC, Harvey RJ, Beck J, Dickinson A, et al. Autopsy-confirmed familial early-onset Alzheimer disease caused by the L153V presenilin 1 mutation. Arch Neurol 2001; 58: 953–8.
Kalaria RN, Cohen DL, Greenberg BD, Savage MJ, Bogdanovic NE, Winblad B, et al. Abundance of the longer Aß42 in neocortical and cerebrovascular amyloid ß deposits in Swedish familial Alzheimer’s disease and Down’s syndrome. Neuroreport 1996; 7: 1377–81.[Web of Science][Medline]
Kalaria RN, Ogeng’o JA, Patel NB, Sayi JG, Kitinya JN, Chande HM, et al. Evaluation of risk factors for Alzheimer’s disease in elderly east Africans. Brain Res Bull 1997; 44: 573–7.[CrossRef][Web of Science][Medline]
Kennedy AM, Newman S, Frackowiak RSJ, Cunningham VJ, Roques P, Stevens J, et al. Chromosome 14 linked familial Alzheimer’s disease: A clinico-pathological study of a single pedigree. Brain 1995; 118: 185–205.
Lampe TH, Bird TD, Nochlin D, Nemens E, Risse SC, Sumi SM, et al. Phenotype of chromosome 14-linked familial Alzheimer’s disease in a large kindred. Ann Neurol 1994; 36: 368–78.[CrossRef][Web of Science][Medline]
Lenger V, de Viliers C, Louw SJ. Informant questionnaires as screening measures to detect dementia. A pilot study in the South African context. S Afr Med J 1996; 86 (6 Suppl): 737–41.[Web of Science][Medline]
Levy-Lahad E, Wasco W, Poorkaj P, Romano DM, Oshima J, Pettingell WH, et al. Candidate gene for the chromosome 1 familial Alzheimer’s disease locus. Science 1995a; 269: 973–7.
Levy-Lahad E, Lahad A, Wijsman EM, Bird TD, Schellenberg GD. Apolipoprotein E genotypes and age of onset in early-onset familial Alzheimer’s disease. Ann Neurol 1995b; 38: 678–80.[CrossRef][Web of Science][Medline]
Mann DMA, Pickering-Brown SM, Takeuchi A, Iwatsubo T. Amyloid angiopathy and variability in amyloid ß deposition is determined by mutation position in presenilin-1-linked Alzheimer’s disease. Am J Pathol 2001; 158: 2165–75.
Mayeux R, Stern Y, Spanton S. Heterogeneity in dementia of the Alzheimer type. Evidence of subgroups. Neurology 1985; 35: 453–61.
Mirra SS, Heyman A, McKeel D, Sumi SM, Crain BJ, Brownlee LM, et al. The Consortium to Establish a Registry for Alzheimer’s Disease (CIRAD). Part II. Standardization of the neuropathologic assessment of Alzheimer’s disease. Neurology 1991; 41: 479–86.
Moretti PM, Giordani B, Kluin KJ, Minoshima S, Kuhl DE, Seltzer WK, et al. Early-onset familial Alzheimer’s disease and spastic paraparesis associated with a novel insertional mutation of the presenilin 1 gene [abstract]. Neurobiol Aging 2000; 21 (No. 1S): S175.
O’Connor DW, Pollitt PA, Brook CPB, Reiss BB. The validity of informant histories in a community study of dementia. Int J Geriatr Psychiatry 1989; 4: 203–8.
O’Riordan S, McMonagle P, Janssen JC, Fox NC, Farrell M, Collinge J, et al. Presenilin-1 mutation (E280G), spastic paraparesis, and cranial MRI white-matter abnormalities. Neurology 2002; 59: 1108–10.
Ogeng’o JA, Cohen DL, Sayi JG, Matuja WB, Chande HM, Kitinya JN, et al. Cerebral amyloid ß protein and other Alzheimer lesions in non-demented elderly East Africans. Brain Pathol 1996; 6: 101–7.[Web of Science][Medline]
Premkumar DRD, Cohen DL, Hedera P, Friedland RP, Kalaria RN. Apolipoprotein 4 alleles in cerebral amyloid angiopathy and cerebrovascular pathology associated with Alzheimer’s disease. Am J Pathol 1996; 148: 2083–95.[Abstract]
Prinsloo FR. Health services—needs of the elderly in two black urban areas of the Cape peninsula. S Afr Med J 1991; 79: 485–9.[Web of Science][Medline]
Queralt R, Ezquerra M, Lleo A, Castellvi M, Gelpi J, Ferrer I, et al. A novel mutation (V89L) in the presenilin 1 gene in a family with early onset Alzheimer’s disease and marked behavioural disturbances. J Neurol Neurosurg Psychiatry 2002; 72: 266–9.
Ritchie K, Fuhrer R. A comparative study of the performance of screening tests for senile dementia using receiver operator characteristics analysis. J Clin Epidemiol 1992; 45: 627–37.[CrossRef][Web of Science][Medline]
Rogaev EI, Sherrington R, Rogaeva EA, Levesque G, Ikeda M, Liang Y, et al. Familial Alzheimer’s disease in kindreds with missense mutation in a gene on chromosome 1 related to the Alzheimer’s disease type 3 gene. Nature 1995; 376: 775–8.[CrossRef][Medline]
Rogaeva EA, Fafel KC, Song YQ, Medeiros H, Sato C, Liang Y, et al. Screening for PS1 mutations in a referral-based series of AD cases. 21 novel mutations. Neurology 2001; 57: 621–5.
Rossor MN, Fox NC, Beck J, Campbell TC, Collinge J. Incomplete penetrance of familial Alzheimer’s disease in a pedigree with a novel presenilin-1 gene mutation. Lancet 1996; 347: 1560.[Medline]
Sayi JG, Patel NB, Premkumar DR, Adem A, Winblad B, Matuja WB, et al. Apolipoprotein E polymorphism in elderly east Africans. East Afr Med J 1997; 74: 668–70.[Web of Science][Medline]
Sherrington R, Rogaev EI, Liang Y, Rogaeva EA, Levesque G, Ikeda M, et al. Cloning of a gene bearing missense mutations in early-onset familial Alzheimer’s disease. Nature 1995; 375: 754–60.[CrossRef][Medline]
Singleton AB, Hall R, Ballard CG, Perry RH, Xuereb JH, Rubinsztein DC, et al. Pathology of early-onset Alzheimer’s disease cases bearing the Thr113–114ins presenilin-1 mutation. Brain 2000; 123: 2467–74.
Tang MX, Stern Y, Marder K, Bell K, Gurland B, Lantigua R, et al. The APOE-epsilon4 allele and the risk of Alzheimer disease among African Americans, whites, and Hispanics. JAMA 1998; 279: 751–5.
Tanzi RE, Bertram L. New frontiers in Alzheimer’s disease genetics. Neuron 2001 32: 181–4.[CrossRef][Web of Science][Medline]
Van Broeckhoven C, Backhovens H, Cruts M, Martin JJ, Crook R, Houlden H, et al. APOE genotype does not modulate age of onset in families with chromosome 14 encoded Alzheimer’s disease. Neurosci Lett 1994; 169: 179–80.[CrossRef][Web of Science][Medline]
Yasuda M, Maeda K, Hashimoto M, Yamashita H, Ikejiri Y, Bird TD, et al. A pedigree with a novel presenilin 1 mutation at a residue that is not conserved in presenilin 2. Arch Neurol 1999; 56: 65–9.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  W. C. Low, M. Junna, A. Borjesson-Hanson, C. M. Morris, T. H. Moss, D. L. Stevens, D. St Clair, T. Mizuno, W. W. Zhang, K. Mykkanen, et al. Hereditary multi-infarct dementia of the Swedish type is a novel disorder different from NOTCH3 causing CADASIL Brain, February 1, 2007; 130(2): 357 - 367. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Edwards-Lee, J. M. Ringman, J. Chung, J. Werner, A. Morgan, P. St. G. Hyslop, P. Thompson, R. Dutton, A. Mlikotic, E. Rogaeva, et al. An African American family with early-onset Alzheimer disease and an APP (T714I) mutation Neurology, January 25, 2005; 64(2): 377 - 379. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||