Brain Advance Access originally published online on October 13, 2004
Brain 2004 127(12):2682-2692; doi:10.1093/brain/awh301
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Brain Vol. 127 No. 12 © Guarantors of Brain 2004; all rights reserved
Dysfunction of the brain calcium channel CaV2.1 in absence epilepsy and episodic ataxia
1 Departments of Molecular Neuroscience and Clinical and Experimental Epilepsy, Institute of Neurology, University College London, Queen Square, London WC1N 3BG, 2 Department of Paediatrics, University College London, London WC1E 6JJ, UK and 3 Department of Neurology, Louisiana State University School of Medicine, Shreveport, LA 71103, USA
Correspondence to: Dr M. G. Hanna, Box 102, National Hospital for Neurology and Neurosurgery, Queen Square, London WC1N 3BG, UK E-mail: mhanna{at}ion.ucl.ac.uk
.
Received February 6, 2004. Revised June 30, 2004. Accepted July 30, 2004.
| Summary |
|---|
|
|
|---|
The molecular basis of idiopathic generalized epilepsy remains poorly understood. Absence epilepsy with 3 Hz spikewave EEG is one of the most common human epilepsies, and is associated with significant morbidity. Several spontaneously occurring genetic mouse models of absence epilepsy are caused by dysfunction of the P/Q-type voltage-gated calcium channel CaV2.1. Such mice exhibit a primary generalized spikewave EEG, with frequencies in the range of 57 Hz, often associated with ataxia, evidence of cerebellar degeneration and abnormal posturing. Previously, we identified a single case of severe primary generalized epilepsy with ataxia associated with CaV2.1 dysfunction, suggesting a possible link between this channel and human absence epilepsy. We now report a family in which absence epilepsy segregates in an autosomal dominant fashion through three generations. Five members exhibit a combination of absence epilepsy (with 3 Hz spikewave) and cerebellar ataxia. In patients with the absence epilepsy/ataxia phenotype, genetic marker analysis was consistent with linkage to the CACNA1A gene on chromosome 19, which encodes the main pore-forming
1A subunit of CaV2.1 channels (CaV2.1
1). DNA sequence analysis identified a novel point mutation resulting in a radical amino acid substitution (E147K) in CaV2.1
1, which segregated with the epilepsy/ataxia phenotype. Functional expression studies using human CACNA1A cDNA demonstrated that the E147K mutation results in impairment of calcium channel function. Impaired function of the brain calcium channel CaV2.1 may have a central role in the pathogenesis of certain cases of primary generalized epilepsy, particularly when associated with ataxia, which may be wrongly ascribed to anticonvulsant medication.
Key Words: calcium channel; epilepsy; channelopathy; ataxia
Abbreviations: AEA = absence epilepsy with ataxia; AED = anti-epileptic drug; EA2 = episodic ataxia type 2; EGFP = enhanced green fluorescent protein
| Introduction |
|---|
|
|
|---|
The neuronal channelopathies are an expanding group of single gene disorders (Kullmann et al., 2002
Several spontaneously occurring homozygous mouse mutants represent good models for human absence epilepsy, notably tottering, leaner, rocker, rolling Nagoya, lethargic, ducky and stargazer (Burgess and Noebels, 1999
; Fletcher et al., 1999
; Felix et al., 2002
). These mice harbour mutations in the genes coding for subunits making up brain CaV2.1 (also known as P/Q-type) voltage-gated Ca2+ ion channels (Mori et al., 1991
; Catterall et al., 2000
), which are strongly expressed in the cell bodies and dendrites of cerebellar Purkinje and granule cells (Westenbroek et al., 1995
), but also mediate much of the calcium influx that triggers transmitter release at synapses throughout the nervous system. Several of these strains exhibit episodes of motor arrest with spikewave EEG similar to that seen in human absence epilepsy, but in addition have cerebellar degeneration, ataxia and dystonia. Interestingly, these models also share some features with another autosomal dominant disease, episodic ataxia type 2 (EA2). EA2 is characterized by severe and prolonged attacks of cerebellar ataxia and dysarthria often associated with diplopia or headache. Patients often develop a progressive interictal cerebellar syndrome due to cerebellar damage, which is supported by MRI evidence of vermian atrophy (Griggs et al., 1978
; Vighetto et al., 1988
). EA2 is caused by several different mutations in CACNA1A, localized on chromosome 19p, which codes for CaV2.1
1, the
1A subunit of the CaV2.1 Ca2+ channel (Ophoff et al., 1996
; Denier et al., 1999
; Yue et al., 1997
, 1998
).
We previously have suggested a link between this calcium channel and human absence epilepsy occurring in combination with cerebellar ataxia: we described a singleton case of a child harbouring a novel heterozygous CACNA1A mutation, who showed a phenotype characterized by the early onset of absence epilepsy and cerebellar ataxia (Jouvenceau et al., 2001
). The mutation gave rise to a premature stop codon, leading to the smallest truncation yet observed, predicted to lead to the loss of the cytoplasmic C-terminus of the CaV2.1
1 subunit. Heterologous expression of the mutated CaV2.1
1 subunit indicated a complete loss of function, and therefore a profound decrease in Ca2+ current. Because this mutation was a de novo event in a single patient, this case left unanswered the question of whether CACNA1A mutations play a significant role in human absence epilepsy. A further mutation in CACNA1A, predicted to result in a frameshift and premature stop codon, has been reported in association with EA2 and epilepsy, but without details of the seizure type (Jen et al., 2004
).
We now describe a new family in which six members in three generations exhibited a typical primary generalized 3 Hz spike wave EEG abnormality. Five of these individuals exhibited clinical absence epilepsy with ataxia (AEA). All the AEA cases harboured a novel point mutation in the CACNA1A gene, which impaired calcium channel function.
| Methods |
|---|
|
|
|---|
Linkage analysis
Genomic DNA was obtained from 11 family members, including five with the AEA phenotype and one with EEG changes only. DNA was extracted from white blood cells using standard methodology (Miller et al., 1988
Mutation detection
DNA was extracted from all available family members using standard procedures. Each exon and the flanking intronic regions of CACNA1A was amplified by polymerase chain reaction (PCR). Each exon was then analysed by direct DNA sequencing on an ABI 377 Sequencer (Applied Biosystems, Foster City, CA). Primers and PCR conditions are available from the authors on request. Restriction fragment length polymorphism analysis was used to screen 200 control chromosomes and to confirm segregation of the mutation with disease in the family.
cDNA construction
The E147K mutation identified in this study (see Results) was introduced into human CACNA1A cDNA (CaV2.1
1) with a PCR-based strategy using proofreading DNA polymerase (Pfu, Promega). The cDNA was the same as used by Hans et al. (1999)
and Guida et al. (2001)
. Four primers were used in three separate PCRs. Forward primer 1 (f1) TGTCAAGCTTGCGGTGTGGCAGG, forward primer 2 (f2) GGAATTTTTTGTTTCAAGGCTGGAATTAAAATC, reverse primer 1 (r1) GATTTTAATTCCAGCCTTGAAACAAAAAATTCC and reverse primer 2 (r2) TAGCAACACACAGCGGTGTTGAG. Primers f1 and r2 flank the region of interest and lie 5' to a BglII restriction site and 3' to a DraIII restriction site, respectively. Primer pairs f1/r1 and f2/r2 were used in two separate reactions on h
1A in expression plasmid pMT2 LF. The products from these two reactions were used in a third reaction along with primers f1 and r2 to yield the full-length product. This was digested with the enzymes BglII and DraIII and subcloned into CACNA1A-pMT2 LF, which had been cut accordingly. The sequence of the mutated CACNA1A cDNA was verified using a fluorescent BigDye terminator sequencing kit (Applied Biosystems).
For the construction of the enhanced green fluorescent protein (EGFP)CaV2.1
1 fusion plasmid, the entire coding sequence of either the wild-type or the mutant channel (BamHISalI) was subcloned into the BglIISalI sites of the pEGFP-C3 expression vector (Clontech). This generates a fusion protein with the EGFP sequence appended to the N-terminus of the channel.
Functional expression in oocytes
Female Xenopus laevis frogs were killed with 0.5% tricaine, decapitation and pithing. Stage VVI oocytes were isolated and stored at 418°C in fresh ND96 medium (NaCl 96 mmol/l, KCl 2 mmol/l, MgCl2 1 mmol/l, CaCl2 1.8 mmol/l, HEPES 5 mmol/l, gentamicin 50 µg/ml pH 7.4; sterilized by filtration).
CACNA1A cDNA was injected into the nuclei of the oocytes (Nanoject, Drummond, Broomall, PA) together with cDNA encoding the auxiliary subunits ß4 and
2
1 (provided by A. Dolphin, University College London). cDNA (9.2 nl) was injected at a concentration of 0.61.0 mg/ml. For wild-type or mutant expression, cDNAs encoding CaV2.1
1, ß4 and
2
1 were injected in a ratio of1 : 1 : 1. For co-expression experiments, wild-type CaV2.1
1, mutant CaV2.1
1, ß4 and
2
1 were injected in a ratio of 1 : 1 : 2 : 2. The total concentration of cDNA, determined from optical density, was constant in each case and the results were normalized by the wild-type amplitude recorded on the same day within the same batch of oocytes. Normalized amplitudes were then averaged between batches.
Whole-cell currents were measured with a two-electrode voltage clamp 34 days after injection (Geneclamp 500B, Axon Instruments, Union City, CA). Currents were filtered at 1 kHz and sampled at 5 kHz. The perfusion solution used to record Ba2+ currents contained Ba(OH)2 (40 mmol/l), NaOH (50 mmol/l), KOH (1 mmol/l), niflumic acid (0.4 mmol/l) and HEPES (10 mmol/l), with pH adjusted to 7.4 with methanesulphonic acid, and was kept at room temperature. The voltage dependence of activation was obtained by plotting the normalized tail currents recorded at 50 mV as a function of the pre-pulse potential (from 80 to +65 mV). The voltage dependence of inactivation (steady-state inactivation) was determined from the normalized inward current elicited during steps to +10 mV after 10 s steps to various holding potentials (from 140 to +40 mV). Data were fitted with the Boltzmann function: I = 1/[1 + exp{(V V1/2)/k}] from which V1/2 and the slope factor k, for activation and steady-state inactivation, were computed. Inactivation during depolarization was estimated during 3 s pulses from a holding potential of 90 mV to a test potential of +10 mV. Traces were fitted with a double exponential function from which the time constants and relative amplitudes of the fast (
fast, %fast) and slow (
slow, %slow) components were obtained. The rate of current activation was estimated from the 1090% rise time for currents evoked by test pulses ranging from 80 to +40 mV from a holding potential of 90 mV.
Data were acquired and analysed with Pclamp6 (Axon Instruments) and Origin 6.0 (Microcal). Significance was tested with unpaired t tests with Bonferroni correction for multiple comparisons.
Confocal laser scanning microscopy
Oocytes were injected with cDNA encoding EGFPCaV2.1
1, ß4 and
2
1 as above, with the same ratios of wild-type and mutant CACNA1A. Following incubation for 3 days, they were fixed in 4% paraformaldehyde [v/v in 0.15 M phosphate-buffered saline (PBS)] for at least 3 h at 4°C, and were then cut in half, perpendicular to the equator. Each half was submerged in ND96 medium and imaged on the cytoplasmic side, followed by the membrane side, obtaining four images per oocyte.
Fluorescence images were acquired at 10x magnification using a Bio-Rad Radiance2000 laser scanning confocal microscope with an 8 bit ADC, using Lasersharp software (Bio-Rad) for acquisition and Scion Image software (NIH) for analysis. EGFP was excited using a 488 nm argon laser beam, with an emission filter of 515/30 nm to collect the peak emission (507 nm). Laser and confocal aperture settings were kept constant for all experiments. A Z-stack was acquired at 10 µm steps and then projected onto a single image for analysis.
The images taken from the cytoplasmic aspect were subdivided into (i) an annulus corresponding to the membrane and immediately submembrane area (7 µm from the edge) and (ii) the remainder of the cytoplasm, including nucleus and juxta-nuclear endosomes. The mean pixel value within each region was divided by its area, and then averaged with the measurement obtained from the second half of the oocyte, to give a mean fluorescence value. The membrane fluorescence value obtained from the surface view was added to that obtained in the membrane annulus of the cytoplasmic view, to obtain an estimate for the fluorescence associated with the plasmalemma. The cytoplasmic mean fluorescence values for each cell were then averaged between oocytes. As a measure of total cell fluorescence, the membrane and cytoplamsic data were first averaged for each cell, and then among all cells.
| Results |
|---|
|
|
|---|
Clinical data
We ascertained a large North American pedigree in which five members exhibited absence epilepsy (3 Hz spikewave EEG) with variable degrees of episodic and anticonvulsant drug-induced cerebellar ataxia; we have used the abbreviation AEA for this phenotype. One individual had a typical 3 Hz spikewave EEG but had no clinical phenotype, and was neurologically normal (III:2 below). This family has been assessed in detail and followed-up since 1988 by one of us (S.L.J.). We performed clinical, EEG and genetic analyses on 11 genetically related individuals and one non-blood relative who had married into the family. Brain imaging was also undertaken in certain cases. The key clinical and investigative details of these individuals are shown in Tables 1 and 2.
|
|
The range of the clinically penetrant phenotype is illustrated by the following two case histories.
Case II:6 (index case) presented at the age of 39 years with a history of dizzy attacks stretching back to teenage years. This had worsened in the year prior to assessment. A typical attack consisted of sudden onset disequilibrium with associated headache and nausea. The patient was unable to walk during the attacks because of ataxia and had to lie down. Attacks lasted between 1 and 8 h, and could be precipitated by stress and anxiety.
In addition, there was a history of blank episodes suggestive of absence seizures from late childhood which subsided in adult life when the ataxic episodes were the major clinical problem. In the absence attacks, typically there would be motor arrest without warning, lasting seconds. Postural tone was not lost. Generally, the patient was able to resume normal activities immediately. On other occasions, there were more prolonged atypical absence episodes. During one EEG examination, the patient developed a prolonged fugue-like state lasting several hours accompanied by generalized 3 Hz spikewave discharges. A CT brain scan revealed mild midline cerebellar atrophy, but neurological examination was normal. An MRI of the brain confirmed the presence of cerebellar vermian atrophy. Her symptoms remitted on a combination of acetazolamide and carbamazepine. However, it was particularly notable that she exhibited marked cerebellar ataxia when antiepileptic drug (AED) levels were even in the mid-therapeutic range. She was given a diagnosis of EA2 with absence epilepsy.
Case III:3 exhibits a more severe younger onset phenotype with striking similarities to the original case of EA2/epilepsy reported by Jouvenceau et al. (2001)
. Absence attacks characterized by motor arrest without warning developed from age 4 years. Attacks were very brief (seconds) and apparently normal behaviour resumed. No clonic jerking or automatisms were reported during the episodes. Early motor milestones were considered delayed, being a clumsy walker and not ambulating until age 2.5 years. An initial EEG confirmed a polyspikewave primary generalized abnormality; further EEGs demonstrated generalized 3 Hz spikewave changes. His seizures were not easily controlled by several AEDs including clonazepam and phenytoin. It had been noted that he was considered very sensitive to AEDs with a tendency to develop marked cerebellar ataxia even with low therapeutic doses of phenytoin and other medications. On one occasion, he developed extreme cerebellar ataxia and a decreased level of consciousness. Although there was no clear-cut history of episodes of cerebellar ataxia, examination at the age of 10 years revealed moderate fixed cerebellar signs. He had some learning disabilities and was considered to have cognitive impairment, but no clear speech difficulty. He was considered to require special education which he entered at the age of 8 years. It is considered that he will not achieve independent employment. Unfortunately, formal neuropsychometry is not available.
Genetic studies
Linkage analysis
The maximum simulated LOD score was 2.4 at
= 0. Five of the seven microsatellite markers were informative in this family. The five affected individuals shared a single common haplotype between D19S914 and D19S840 (Fig. 1). This haplotype was not shared by any of the unaffected individuals. The maximum multipoint LOD score across this haplotype was 2.1. The AEA phenotype in this pedigree was thus consistent with linkage to CACNA1A.
|
CACNA1A gene DNA sequence analysis
We identified a heterozygous point mutation (G439A) in exon 3 of CACNA1A, which results in a substitution of lysine for glutamic acid at codon 147 (E147K). This previously unreported change segregated with the AEA disease phenotype. The mutation was not detected in unaffected individuals or in the patient with an abnormal EEG but no clinical phenotype [case III:2]. All family members were sequenced. The mutation identified results in the loss of a TaqI restriction site. With wild-type exon 3, the 203 bp product is cut into a 165 bp fragment and a 38 bp fragment (the latter runs off the gel). With the heterozygous E147K mutation, an uncut fragment at 203 bp is seen in addition to the band at 165 bp (Fig. 2). This mutation was absent from a panel of 200 control chromosomes, and segregation of the mutant with the AEA disease was confirmed in the family (Fig. 1). The mutation affects a highly conserved residue within the second transmembrane segment of domain I of CaV2.1
1, as assessed by an interspecies comparison (Fig. 3).
|
|
Functional consequences of the E147K mutation
Electrophysiology
To investigate the functional consequences of the E147K mutation, wild-type and/or mutant CaV2.1
1 were expressed in Xenopus oocytes, together with auxiliary subunits
2
1 and ß4. Wild-type CaV2.1
1 expression gave typical CaV2.1 currents elicited with a depolarizing ramp protocol from 90 to +90 mV. The mutant CaV2.1
1 was functional but showed reduced current expression (P < 0.0005; Table 3 and Fig. 4A). Jouvenceau et al. (2001)
1, when inserted into the rabbit BI-1 cDNA encoding CaV2.1
1 (although this effect was not seen when inserted into the human cDNA; P. Imbrici and D. M. Kullmann, unpublished observations). We therefore co-expressed E147K with wild-type CaV2.1
1 (together with the accessory subunits). The peak current amplitude mediated by co-expressed wild-type and mutant CaV2.1
1 was consistent with linear summation of the currents mediated by each subunit separately (Fig. 4B; Table 3). These results thus argue that the mutation causes a decrease in current amplitude but without evidence for a dominant-negative interaction with the wild-type subunit.
|
|
The accessory subunits
2
1 and ß4 contribute to targeting of calcium channels to the plasma membrane, and also affect their biophysical properties (de Waard et al., 1995
1 limits the number of channels reaching the membrane. In contrast, doubling the amount of
2
1 and ß4 cDNA led to an increase in current mediated by channels containing the mutant CaV2.1
1 (Fig. 4C). Indeed, the current reached the amplitude of wild-type.
The effect of increasing the availability of
2
1 and ß4 is consistent with impaired membrane targeting, which can be overcome by increasing the abundance of accessory subunits. However, because accessory subunits also affect calcium channel kinetics, and because impaired activation of CaV2.1 could also explain the results, we examined the effect of the E147K mutation on the voltage- and time-dependent kinetics of the channel (Figs 5 and 6; Table 3). The voltage dependence of activation for the mutant channel, measured with depolarizing membrane potential steps, showed a small shift towards more positive potentials, although this failed to reach significance (Fig. 5A and B). When co-expressed with the wild-type subunit, this effect on activation threshold disappeared, consistent with the fact that most of the current was mediated by wild-type channels. There was no significant difference in the apparent reversal potential (Table 3). The voltage dependence of steady-state inactivation also did not differ among oocytes expressing wild-type channels, mutant channels or both (Fig. 5C).
|
|
The rate of activation, estimated from the 1090% rise time, showed a non-significant slowing for the mutant (Fig. 6A). Finally, we examined the rate of activation and inactivation evoked by 3 s pulses to different voltages between 20 and +30 mV (Fig. 6B and C). Inactivation was fitted by a double exponential time course. The slow component of inactivation showed a small prolongation relative to wild-type, which reached significance at P < 0.05 (Table 3). This was also seen for the weighted time constant (calculated as
fast %fast +
slow %slow).
Membrane expression of EGFPCaV2.1
1
The functional analysis of the E147K mutation indicates a partial loss of function, which can be rescued by increasing the availability of accessory subunits, and a small slowing of inactivation. Because the most robust effect could be explained by impaired membrane targeting, we examined the fluorescence intensity of oocytes expressing mutant or wild-type EGFPCaV2.1
.1 or uninjected oocytes.
We first measured the biophysical properties of the fusion proteins, to determine whether the presence of EGFP at the N-terminus has an effect on current density, or voltage- and time-dependent kinetics. The EGFP tag did not interfere with the function of the channel. There were no differences in current density, currentvoltage relationship and rate of activation. We then assessed the fluorescence distribution in the oocytes (Fig. 7). Oocytes show considerable autofluorescence, which was measured in uninjected oocytes to permit analysis of the effects of expressing EGFPCaV2.1
1. The membrane mean fluorescence of oocytes injected with mutant EGFPCaV2.1
1 was significantly reduced compared with wild-type EGFPCaV2.1
.1-injected oocytes (Fig. 8A). However, the cytoplasm mean fluorescence measured for the same cells was not different (Fig. 8B). These data suggest that a reduction in the number of mutant channels reaching the membrane could account for the reduced current level.
|
|
| Discussion |
|---|
|
|
|---|
This is the first reported family in which typical absence seizures co-segregate with a CACNA1A mutation that impairs Cav2.1 function. These data strongly argue that dysfunction of Cav2.1, observed in several mouse models of absence epilepsy, plays a role in the aetiology of human absence epilepsy.
Affected members in this family exhibited a wide range of phenotypic severity, despite the presence of the same pathogenic mutation. In some cases, the ataxia component of the phenotype was indistinguishable from EA2, whereas in others the major feature was marked ataxia in response to AEDs at normally non-toxic doses. In all affected cases, the EEG showed classical 3 Hz spikewave discharges characteristic of typical absence epilepsy. Although the phenotypic severity was variable in this family, it was generally milder than in a singleton case with a de novo CACNA1A mutation that first suggested that Cav2.1 dysfunction can underlie human absence epilepsy (Jouvenceau et al., 2001
). This case had severe very progressive ataxia, poorly controlled epilepsy and mental retardation. In contrast, affected members in the present family have a generally milder phenotype often indistinguishable from commonly encountered absence epilepsy, which affects
0.5% of all children. Generally, the absence epilepsy in this family was controlled with medication. It is notable that when ataxia is encountered in such children, it is commonly ascribed to AED toxicity.
The missense mutation identified in the present family gives rise to an amino acid substitution (E147K) in the second transmembrane segment of domain I of CaV2.1
1. Although this is a highly conserved residue, it had a relatively subtle effect on the function of the channel, compared with the premature stop codon (R1820X) identified in the previously reported case. R1820X led to a complete loss of function and, when inserted in the rabbit cDNA BI-1, it also showed a dominant-negative effect on the wild-type subunit, similar to that reported for experimental truncations of the closely related subunit CaV2.2
1 (Raghib et al., 2001
). The molecular mechanism of this interaction is unclear, but may involve misfolding of the wild-type protein when it encounters the mutant peptide. Moreover, although we subsequently have confirmed that the R1820X mutation is non-functional when inserted in the human CaV2.1
1 cDNA, the dominant-negative effect is no longer seen, suggesting that it may depend on the splice variant represented by the cDNA chosen for expression (P. Imbrici and D. M. Kullmann, unpublished). In contrast to these severe effects on channel function, the mutation identified in the present family only produced a partial reduction in calcium channel function, which could be rescued by overexpression of accessory subunits. The results of EGFP fluorescence imaging imply that the mutation impairs trafficking to the membrane. We cannot, however, exclude an effect on channel opening probability, although the kinetic measurements only revealed a modest slowing of inactivation.
We tentatively suggest that the main deficit in the affected members of this family is a reduction in membrane expression of CaV2.1. This is subject to the caveat that it is not known whether availability of accessory subunits is a limiting factor in membrane expression in vivo. Moreover, CACNA1A undergoes extensive splicing (which may underlie the discrepancies in R1820Xwild-type interaction that we have observed previously), further confounding the interpretation of the results. If the major effect is a decrease in membrane expression, the milder effect in vitro accords with the generally milder disease pattern than seen for R1820X. Impaired trafficking of the mutant CaV2.1
1 contrasts with the effects of other mutations associated with episodic ataxia without epilepsy. These have been reported either to be non-functional (with, in one case, intact membrane expression; Guida et al., 2001
) or to impair channel function, either by shifting the voltage dependence of activation to more positive potentials or by reducing the open channel probability (Wappl et al., 2002
).
A decrease in CaV2.1 current density is also seen in cerebellar neurons studied in acute brain slices from several homozygous mice with mutations of genes encoding CaV2.1
1, ß4 and
2
2 (Wakamori et al., 1998
; Jun et al., 1999
; Lin et al., 1999
; Barclay et al., 2001
; Fletcher et al., 2001
). These mice frequently have ataxia and behavioural arrest with spikewave EEG, reminiscent of the AEA phenotype of the present family. Several of these strains show cerebellar degeneration, also seen in the patients, which presumably does not result from an excessive Ca2+ influx via CaV2.1 channels but instead may arise from a decrease. However, compensatory alterations in other high threshold calcium channels have also been reported in mutant mice (Campbell et al., 1999
; Fletcher et al., 2001
). A toxic effect of mutations on cerebellar neurons is unlikely to explain either the paroxysmal nature of the ataxiadoes or the occurrence of absence seizures, which are thought to originate from imbalance of the thalamocortical circuitry (Huntsman et al., 1999
). Some preliminary work from mutant mice implies that CaV2.1 mutations disturb the balance of GABA and glutamate release from presynaptic boutons (Caddick et al., 1999
). Spontaneous mutations in CaV2.1 subunits associated with spikewave seizures also show an increase in low threshold Ca2+ currents mediated by T-type channels (Zhang et al., 2002
). If this also occurs in association with the E147K mutation, it provides a compelling mechanism for the initiation of absence-type seizures in the present family: human mutations of CACNA1H, encoding the T-type channel subunit CaV3.2
1, have been identified in sporadic cases of childhood absence epilepsy (Chen et al., 2003
), and some of these have been shown to lead to a gain of function of this channel subtype (Khosravani et al., 2004
). T-type channels are also a target of ethosuximide (Gomora et al., 2001
), which, although not tried in the family described here, has a useful anti-absence profile.
The observation of a single member of the present family with a classical 3 Hz spikewave EEG but with no epilepsy or ataxia phenotype requires further consideration. This individual did not have the E147K mutation, arguing for another cause for the EEG abnormality. (The absence of the mutation was confirmed on two further occasions from two separate blood samples, ruling out sample mislabelling.) One important possibility is that a second gene variant was inherited in this family, which, on its own, gives rise to the EEG abnormality, but is insufficient to give rise to absence seizures, let alone episodic ataxia. We cannot exclude the possibility that this variant was also inherited by the affected members, and that the AEA phenotype is actually a manifestation of digenic inheritance, as has been suggested to occur in another family with epilepsy (Baulac et al., 2001
). If a second gene was indeed inherited in this family, what is the probability that it, on its own, was responsible for the abnormal EEG, and not the E147K mutation? A simple calculation argues strongly that this is very low: the probability that the allele corresponding to the abnormal EEG would be inherited from case I:1 by the affected cases in the second and third generations, and not by the unaffected cases (excluding the unaffected branch of the family III:1) is 1 : 29 or <0.002.
In conclusion, this family provides strong evidence that dysfunction of Cav2.1 is implicated in certain cases of human absence epilepsy, and adds to previous indirect suggestions for such a link from mutant mice, from previous sporadic cases (Escayg et al., 2000b
; Jouvenceau et al., 2001
) and from linkage disequilibrium associating idiopathic generalized epilepsy with the CACNA1A locus (Chioza et al., 2001
). From a clinical viewpoint, we suggest that the presence of cerebellar ataxia, either episodic or in response to moderate doses of AEDs, increases the liklehood that CaV2.1 dysfunction may be involved. CaV2.1 variants may act in combination with other as yet unidentified genetic factors to produce the clinical phenotype of AEA in combination with a primary generalized 3 Hz spike wave disturbance.
| FOOTNOTES |
|---|
* These authors contributed equally to this work
| Acknowledgements |
|---|
We wish to thank K. A. Stauderman for the gift of the CACNA1A, A. Dolphin for
2
1 and ß4 and the expression vector pMT2 LF, and to S. Maltas for assistance with molecular biology. Supported by the University College Hospitals Special Trustees, Wellcome Trust and MRC. | References |
|---|
|
|
|---|
Barclay J, Balaguero N, Mione M, Ackerman SL, Letts VA, Brodbeck J, et al. Ducky mouse phenotype of epilepsy and ataxia is associated with mutations in the Cacna2d2 gene and decreased calcium channel current in cerebellar Purkinje cells. J Neurosci 2001; 21: 6095104.
Baulac S, Picard F, Herman A, Feingold J Genin F, Hirsch E, et al. Evidence for digenic inheritance in a family with both febrile convulsions and temporal lobe epilepsy implicating chromosomes 18qter and 1q25q31. Ann Neurol 2001; 49: 78692.[CrossRef][Web of Science][Medline]
Burgess DL, Noebels JL. Single gene defects in mice: the role of voltage-dependent calcium channels in absence models. Epilepsy Res 1999; 36: 11122.[CrossRef][Web of Science][Medline]
Caddick SJ, Wang C, Fletcher CF, Jenkins NA, Copeland NG, Horsford DA. Excitatory but not inhibitory synaptic transmission is reduced in lethargic (Cacnb4(lh)) and tottering (Cacna1atg) mouse thalami. J Neurophysiol 1999; 81: 206674.
Campbell DB, Hess EJ. L-type calcium channels contribute to the tottering mouse dystonic episodes. Mol Pharmacol 1999; 55: 2331.
Catterall WA. Structure and regulation of voltage-gated Ca2+ channels. Annu Rev Cell Dev Biol 2000; 16: 52155.[CrossRef][Web of Science][Medline]
Charlier C, Singh NA, Ryan SG, Lewis TB, Reus BE, Leach RJ, et al. A pore mutation in a novel KQT-like potassium channel gene in an idiopathic epilepsy family. Nat Genet 1998; 18: 535.[CrossRef][Web of Science][Medline]
Chen Y, Lu J, Pan H, Zhang Y, Wu H, Xu K, et al. Association between genetic variation of CACNA1H and childhood absence epilepsy. Ann Neurol 2003 54: 23943.[CrossRef][Web of Science][Medline]
Chioza B, Wilkie H, Nashef L, Blower J, McCormick D, Sham P, et al. Association between the alpha(1a) calcium channel gene CACNA1A and idiopathic generalized epilepsy. Neurology 2001; 56: 12456.
Denier C, Ducros A, Vahedi K, Joutel A, Thierry P, Ritz A. High prevalence of CACNA1A truncations and broader clinical spectrum in episodic ataxia type 2. Neurology 1999; 52: 181621.
de Waard M, Campbell KP. Subunit regulation of the neuronal
1A calcium channel. J Physiol (Lond) 1995; 485: 61934.
Escayg A, MacDonald BT, Meisler MH, Baulac S, Huberfeld G, An-Gourfenkel I, et al. Mutations of SCN1A, encoding a neuronal sodium channel, in two families with GEFS+2. Nat Genet 2000a; 24: 3435.[CrossRef][Web of Science][Medline]
Escayg A, De Waard M, Lee DD, Bichet D, Wolf P. Coding and noncoding variation of the human calcium-channel 4-subunit gene CACNB4 in patients with idiopathic generalized epilepsy and episodic ataxia. Am J Hum Genet 2000b; 66: 15319.[CrossRef][Web of Science][Medline]
Felix R. Insights from mouse models of absence epilepsy into Ca2+ channel physiology and disease etiology. Cell Mol Neurobiol 2002; 22: 10320.[CrossRef][Web of Science][Medline]
Fletcher CF, Frankel WN. Ataxic mouse mutants and molecular mechanisms of absence epilepsy. Hum Mol Genet 1999; 8: 190712.
Fletcher CF, Tottene A, Lennon VA, Wilson SM, Dubel SJ, Paylor R, et al. Dystonia and cerebellar atrophy in Cacna1a null mice lacking P/Q calcium channel activity. FASEB J 2001 15: 128890.
Gomora JC, Daud AN, Weiergraber M, Perez-Reyes E. Block of cloned human T-type calcium channels by succinimide antiepileptic drugs. Mol Pharmacol 2001; 60: 112132.
Griggs RC, Moxley RTd, Lafrance RA, Mc Quillen J. Hereditary paroxysmal ataxia: response to acetazolamide. Neurology 1978; 28: 125964.
Guida S, Trettel F, Pagnutti S, Mantuano E, Tottene A, Veneziano L, et al. Complete loss of P/Q calcium channel activity caused by a CACNA1A missense mutation carried by patients with episodic ataxia type 2. Am J Hum Genet 2001; 68: 75964[CrossRef][Web of Science][Medline]
Hans M, Luvisetto S, Williams ME, Spagnolo M, Urrutia A, Tottene A, et al. Functional consequences of mutations in the human alpha1A calcium channel subunit linked to familial hemiplegic migraine. J Neurosci 1999; 19: 16109.
Haug K, Warnstedt M, Alekov AK, Sander T, Ramirez A, Poser B, et al. Mutations in CLCN2 encoding a voltage-gated chloride channel are associated with idiopathic generalized epilepsies. Nat Genet 2003; 33: 52732.[CrossRef][Web of Science][Medline]
Heron SE, Phillips HA, Mulley JC, Mazarib A, Neufeld MY, Berkovic SF, et al. Genetic variation of CACNA1H in idiopathic generalized epilepsy. Ann Neurol 2004; 55: 5956.[CrossRef][Web of Science][Medline]
Huntsman MM, Porcello DM, Homanics GE, DeLorey TM, Huguenard JR. Reciprocal inhibitory connections and network synchrony in the mammalian thalamus. Science 1999; 283: 5413.
Jen J, Kim GW, Baloh RW. Clinical spectrum of episodic ataxia type 2. Neurology 2004; 62: 1722.
Jouvenceau A, Eunson LH, Spauschus A, Ramesh V, Zuberi SM, Kullmann DM, et al. Human epilepsy associated with dysfunction of the brain P/Q-type calcium channel. Lancet 2001; 358: 8017.[CrossRef][Web of Science][Medline]
Jun K, Piedras-Renteria ES, Smith SM, Wheeler DB, Lees SB, Lee TG, et al. Ablation of P/Q type Ca2+ channel currents, altered synaptic transmission, and progressive ataxia in mice lacking the
1A subunit. Proc Natl Acad Sci USA 1999; 96: 1524550.
Khosravani H, Altier C, Simms BA, Hamming K, Snutch TP, McRory JE, et al. Gating effects of mutations in the Cav3.2 T-type calcium channel associated with childhood absence epilepsy. J Biol Chem. In press 2004.
Kruglyak L, Daly MJ, Reeve-Daly MP, Lander ES. Parametric and nonparametric linkage analysis: a unified multipoint approach. Am J Hum Genet 1996; 58: 134763[Web of Science][Medline]
Kullmann DM, Hanna MG. Neurological disorders caused by inherited ion-channel mutations. Lancet Neurol 2002; 1: 15766.[CrossRef][Web of Science][Medline]
Lin FH, Sureyya B, Lutz CM, Wang Y, Hosford DA. Decreased 45Ca2+ uptake in P/Q-type calcium channels in homozygous lethargic (cacnb4lh) mice is associated with increased ß3 and decreased ß4 calcium channel subunit mRNA expression. Brain Res Mol Brain Res 1999; 71: 120[Medline]
Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988; 16: 1215
Mori Y, Friedrich T, Kim MS, Mikami A, Nakai J, Ruth P, et al. Primary structure and functional expression from complementary DNA of a brain calcium channel. Nature 1991; 350: 398402.[CrossRef][Medline]
Ophoff RA, Terwindt GM, Vergouwe MN, van Eijk R, Oefner PJ, Hoffman SM et al. Familial hemiplegic migraine and episodic ataxia type-2 are caused by mutations in the Ca2+ channel gene CACNL1A4. Cell 1996; 87: 54352.[CrossRef][Web of Science][Medline]
Ott J. Computer-simulation methods in human linkage analysis. Proc Natl Acad Sci USA 1989; 86: 41758.
Raghib A, Bertaso F, Davies A, Page KM, Meir A, Bogdanov Y, et al. Dominant-negative synthesis suppression of voltage-gated calcium channel Cav2.2 induced by truncated constructs. J Neurosci 2001; 21: 8495504.
Singh NA, Charlier C, Stauffer D, DuPont BR, Leach RJ, Melis R, et al. A novel potassium channel gene, KCNQ2, is mutated in an inherited epilepsy of newborns. Nat Genet 1998; 18: 259.[CrossRef][Web of Science][Medline]
Sugawara T, Tsurubuchi Y, Agarwala KL, Ito M, F Ukuma G, Mazaki I, et al. A missense mutation of the Na+ channel alpha II subunit gene Na(v)1.2 in a patient with febrile and afebrile seizures causes channel dysfunction. Proc Natl Acad Sci USA 2001; 98: 63849.
Trettel F, Mantuano E, Calabresi V, Veneziano L, Olsen AS, Georgesca A, et al. A fine physical map of the CACNA1A gene region on 19p13.1p13.2 chromosome. Gene 2000; 241: 4550[CrossRef][Web of Science][Medline]
Vighetto A, Froment JC, Trillet M, Aimard G, et al. Magnetic resonance imaging in familial paroxysmal ataxia. Arch Neurol 1988; 45: 5479.
Walker D, Bichet D, Campbell KP, De Waard M, et al. A ß4 isoform-specific interaction site in the carboxyl-terminal region of the voltage dependent Ca2+ channel
1A subunit. J Biol Chem 1998; 273: 23617.
Wallace RH, Wang DW, Singh R, Sheffer IE, et al. Febrile seizures and generalized epilepsy associated with a mutation in the Na+-channel beta1 subunit gene SCN1B. Nat Genet 1998; 19: 36670.[CrossRef][Web of Science][Medline]
Wakamori M, Yamazaki K, Matsunodaira H, Teramoto T, et al. Single tottering mutations responsible for the neuropathic phenotype of the P-type calcium channel. J Biol Chem 1998; 273: 3485767.
Wappl E, Koschak A, Poteser M, Sinnegger MJ, Walter D, Eberhart A, et al. Functional consequences of P/Q-type Ca2+ channel Cav2.1 missense mutations associated with episodic ataxia type 2 and progressive ataxia. J Biol Chem 2002 277: 69606.
Weeks DE, Ott J, Lathrop GM. SLINK; a general simulation program for linkage analysis. Am J Hum Genet 1990; 47: A204.
Westenbroek RE, Sakurai T, Elliot EM, Hell JW, et al. Immunochemical identification and subcellular distribution of the alpha 1A subunits of brain calcium channels. J Neurosci 1995; 15: 640318.
Yue Q, Jen JC, Nelson SF, Baloh RW, et al. Progressive ataxia due to a missense mutation in a calcium channel gene. Am J Hum Genet 1997; 61: 107887.[CrossRef][Web of Science][Medline]
Yue Q, Jen JC, Thwe MM, Nelson SF, et al. De novo mutation in CACNA1A caused acetazolamide-responsive episodic ataxia. Am J Med Genet 1998; 77: 298301.[CrossRef][Web of Science][Medline]
Zhang Y, Mori M, Burgess DL, Noebels JL. Mutations in high-voltage-activated calcium channel genes stimulate low-voltage-activated currents in mouse thalamic relay neurons. J Neurosci 2002; 22: 636271.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
R W Labrum, S Rajakulendran, T D Graves, L H Eunson, R Bevan, M G Sweeney, S R Hammans, N Tubridy, T Britton, L J Carr, et al. Large scale calcium channel gene rearrangements in episodic ataxia and hemiplegic migraine: implications for diagnostic testing J. Med. Genet., November 1, 2009; 46(11): 786 - 791. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. L. Ernst, Y. Zhang, J. W. Yoo, S. J. Ernst, and J. L. Noebels Genetic Enhancement of Thalamocortical Network Activity by Elevating {alpha}1G-Mediated Low-Voltage-Activated Calcium Current Induces Pure Absence Epilepsy J. Neurosci., February 11, 2009; 29(6): 1615 - 1625. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Iida, J. Teng, T. Tada, A. Saka, M. Tamai, H. Izumi-Nakaseko, S. Adachi-Akahane, and H. Iida Essential, Completely Conserved Glycine Residue in the Domain III S2 S3 Linker of Voltage-gated Calcium Channel {alpha}1 Subunits in Yeast and Mammals J. Biol. Chem., August 31, 2007; 282(35): 25659 - 25667. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Khosravani and G. W. Zamponi Voltage-gated calcium channels and idiopathic generalized epilepsies. Physiol Rev, July 1, 2006; 86(3): 941 - 966. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kaja, R. C. G. Van de Ven, M. D. Ferrari, R. R. Frants, A. M.J.M. Van den Maagdenberg, and J. J. Plomp Compensatory Contribution of Cav2.3 Channels to Acetylcholine Release at the Neuromuscular Junction of Tottering Mice J Neurophysiol, April 1, 2006; 95(4): 2698 - 2704. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.D. Graves Ion channels and epilepsy QJM, April 1, 2006; 99(4): 201 - 217. [Full Text] [PDF] |
||||
![]() |
C.-J. Jeng, Y.-T. Chen, Y.-W. Chen, and C.-Y. Tang Dominant-negative effects of human P/Q-type Ca2+ channel mutations associated with episodic ataxia type 2 Am J Physiol Cell Physiol, April 1, 2006; 290(4): C1209 - C1220. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Strupp, R. Kalla, T. Freilinger, M. Dichgans, and T. Brandt Dysfunction of the brain calcium channel CaV2.1 in absence epilepsy and episodic ataxia--a comment Brain, June 1, 2005; 128(6): E32 - E32. [Full Text] [PDF] |
||||
![]() |
M. G. Hanna, T. D. Graves, S. Jaffe, P. Imbrici, D. M. Kullmann, and on behalf of the authors Dysfunction of the brain calcium channel CaV2.1 in absence epilepsy and episodic ataxia--authors' response Brain, June 1, 2005; 128(6): E33 - E33. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





), wild-type co-expressed with mutant (
) and mutant E147K alone (). The mutant showed a non-significant shift to depolarized voltages. (C) Voltage dependence of steady-state inactivation.









