Brain Advance Access originally published online on February 27, 2006
Brain 2006 129(5):1306-1318; doi:10.1093/brain/awl044
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Interferon-
inhibits central nervous system remyelination through a process modulated by endoplasmic reticulum stress
1 Department of Neurology, Jack Miller Center for Peripheral Neuropathy, University of Chicago, Chicago, IL, 2 Department of Pathology, Wake Forest University Baptist Medical Center, Winston-Salem, NC, 3 Department of Anatomy and Neurobiology, Virginia Commonwealth University School of Medicine, Richmond, VA and 4 The Skirball Institute, New York University School of Medicine, New York, NY, USA
Correspondence to: Dr Brian Popko, Jack Miller Center for Peripheral Neuropathy, Department of Neurology, University of Chicago, 5841 South Maryland Avenue MC2030, Chicago, IL 60637, USA E-mail: bpopko{at}neurology.bsd.uchicago.edu
 |
Summary |
|---|
 Top Summary IntroductionMaterial and methodsResultsDiscussionReferences |
|---|
Interferon-
(IFN-) is believed to play a deleterious role in the immune-mediated demyelinating disorder multiple sclerosis. Here we have exploited transgenic mice that ectopically express IFN- in a temporally controlled manner in the CNS to specifically study its effects on remyelination in the cuprizone-induced demyelination model and in experimental autoimmune encephalomyelitis (EAE), an animal model of multiple sclerosis. CNS delivery of IFN- severely suppressed remyelination in both models and impaired the clinical recovery of the mice experiencing EAE. These observations correlated with a dramatic reduction of oligodendroglial repopulation in the demyelinated lesions. Moreover, we found that in cuprizone-treated mice the detrimental actions of IFN- were associated with endoplasmic reticulum (ER) stress in remyelinating oligodendrocytes. Compared with a wild-type genetic background, the presence of IFN- in mice heterozygous for a loss of function mutation in the pancreatic ER kinase (PERK), a kinase that responds specifically to ER stress, further reduced the percentage of remyelinated axons and oligodendrocyte numbers in cuprizone-induced demyelinated lesions. Thus, these data suggest that IFN- is capable of inhibiting remyelination in demyelinated lesions and that ER stress modulates the response of remyelinating oligodendrocytes to this cytokine.
Key Words:
ER stress; interferon-; oligodendrocyte; PERK; remyelination
Abbreviations:
BIP = binding immunoglobulin protein; CHOP = CAATT enhancer-binding protein homologous protein; DAPI = 4',6-diamidino-2-phenylindole; EAE = experimental autoimmune encephalomyelitis; ELISA = enzyme-linked immunosorbent assay; EM = electron microscope; ER = endoplasmic reticulum; GFAP = glial fibrillary acidic protein; IFN- = interferon-; IL = interleukin; iNOs = inducible nitric oxide synthase; MBP = myelin basic protein; MHC-I = major histocompatibility complex class I; OPCs = oligodendrocyte precursors; PBS = phosphate-buffered saline; PERK = pancreatic ER kinase; p-eIF-2
= phosphorylated eukaryotic translation initiation factor-2; PID = post-immunization day; TNF- = tumour necrosis factor-; tTA = tetracycline-controlled transactivator
Received October 6, 2005. Revised January 24, 2006. Accepted January 27, 2006.
|
Introduction |
|---|
|
TopSummaryIntroductionMaterial and methodsResultsDiscussionReferences |
|---|
Remyelination is the process by which new myelin sheaths are restored to demyelinated axons, enabling them to regain the ability to carry action potentials by saltatory conduction and to recover lost function. Successful remyelination with corresponding recovery of neurological function is observed in some rodent models of experimental induced demyelination such as the cuprizone model and experimental autoimmune encephalomyelitis (EAE; Franklin, 2002
; Bruck et al., 2003). A variety of demyelinating diseases exist in humans, including multiple sclerosis. Multiple sclerosis is one of the most common causes of neurological disability in young adults, affecting roughly two and a half million people worldwide (Compston and Coles, 2002). In approximately 85% of cases, multiple sclerosis patients present with a relapsing/remitting form of the disease, characterized by acute inflammatory demyelinating episodes followed by decreased inflammation and partial remyelination. Remyelination is insufficient in this disease, and the accumulated load of lesions that fail to remyelinate results in an eventual secondary progressive neurological state (Compston and Coles, 2002; Franklin, 2002; Bruck et al., 2003).
The pleiotropic cytokine interferon- (IFN-), which is secreted by activated T-lymphocytes and natural killer cells, is believed to play a deleterious role in immune-mediated demyelinating disorders, such as multiple sclerosis (Popko et al., 1997; Popko and Baerwald, 1999; Steinman, 2001). This cytokine, which is normally not present in the CNS, is detectable during the symptomatic phase of multiple sclerosis (Panitch, 1992). The administration of IFN- to patients with multiple sclerosis leads to a worsening disease course (Panitch et al., 1987), and treatment of patients with an IFN- antibody delays disability progression (Skurkovich et al., 2001). Transgenic mice that ectopically express IFN- in the CNS display a tremoring phenotype and myelin abnormalities (Corbin et al., 1996; LaFerla et al., 2000; Lin et al., 2005). Nevertheless, the functional importance of IFN-, which has been demonstrated to be present in multiple sclerosis demyelinated lesions (Panitch, 1992; Mycko et al., 2003), on the remyelination process and its underlying mechanisms remain poorly understood.
Recently, we reported that the deleterious effects of IFN- on developmental myelination are mediated, at least in part, by endoplasmic reticulum (ER) stress in oligodendrocytes (Lin et al., 2005). The ER is a membranous labyrinthine network that functions in the synthesis and processing of secretory and membrane proteins. A number of cell stress conditions disrupt ER homeostasis and lead to the accumulation of unfolded or misfolded proteins in the ER lumen, which has been referred to as ER stress (Ma and Hendershot, 2001; Rutkowski and Kaufman, 2004). This stress elicits the unfolded protein response, a functional mechanism by which cells attempt to protect themselves against ER stress. The unfolded protein response involves (i) transcriptional induction of ER chaperone proteins whose function is to both increase folding capacity of the ER and prevent protein aggregation, (ii) translational attenuation to reduce protein overload and subsequent accumulation of unfolded proteins, and (iii) removal of misfolded proteins from the ER through retrograde transport coupled to their degradation by the 26S proteasome. These protective responses act transiently to maintain homeostasis within the ER, but sustained ER stress ultimately leads to the death of the cell (Ma and Hendershot, 2001; Rao et al., 2004; Rutkowski and Kaufman, 2004).
Here we have used transgenic mice that allow for the temporally controlled delivery of IFN- to the CNS (Lin et al., 2004) in combination with the cuprizone (bis-cyclohexanone oxaldihydrazone) induced model of demyelination (Matsushima and Morell, 2001) and EAE, an animal model of multiple sclerosis, to specifically study the effects of IFN- on the remyelination process. We show that CNS delivery of IFN- significantly suppresses remyelination in these demyelination models. Moreover, we demonstrate that pancreatic ER kinase (PERK), a kinase essential for cell survival during ER stress, modulates the severity of remyelination failure in animals ectopically expressing IFN- in cuprizone-treated mice.
|
Material and methods |
|---|
|
TopSummaryIntroductionMaterial and methodsResultsDiscussionReferences |
|---|
Mice, cuprizone treatment and EAE immunization
Line110 GFAP/tTA mice on the C57BL/6 background were mated with line184 TRE/IFN-
on the C57BL/6 background to produce GFAP/tTA;TRE/IFN- double transgenic mice (Lin et al., 2004). Moreover, TRE/IFN- mice were crossed with PERK+/– mice (Harding et al., 2001) on the C57BL/6 background, and the resulting progeny were crossed with GFAP/tTA mice to obtain double transgenic mice that were heterozygous for the PERK mutation. To prevent transcriptional activation of the TRE/IFN- transgene by tetracycline-controlled transactivator (tTA), 0.05 mg/ml doxycycline was added to the drinking water and provided ad libitum from conception. For cuprizone treatment, 6-week-old male mice were fed with a diet of milled mouse chow containing 0.2% cuprizone (Sigma-Aldrich, St Louis, MO, USA) for up to 6 weeks. Subsequently, mice were returned to a normal diet for up to 3 weeks to allow remyelination to occur. For induction of EAE, 6-weeks-old female mice received subcutaneous injections at flanks and tail base of 200 µg myelin oligodendrocyte glycoprotein (MOG) 35–55 peptide emulsified in complete Freund's adjuvant (BD Biosciences, San Jose, CA, USA) supplemented with 600 µg of Mycobacterium tuberculosis (strain H37Ra; BD Biosciences). Two intraperitoneal injections of 400 ng pertussis toxin (List Biological Laboratories, Denver, CO, USA) were given 24 and 72 h later. Clinical score (0 = healthy, 1 = flaccid tail, 2 = ataxia and/or paresis of hindlimbs, 3 = paralysis of hindlimbs and/or paresis of forelimbs, 4 = tetraparalysis, 5 = moribund or death) were recorded daily.
All animal procedures were conducted in complete compliance with the NIH Guide for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of The University of Chicago.
Real-time reverse transcription–polymerase chain reaction (RT–PCR)
Mice were perfused with ice-cold phosphate-buffered saline (PBS). RNA was isolated from the spinal cord and corpus callosum (Jurevics et al., 2002) using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and treated with DNAseI (Invitrogen) to eliminate genomic DNA. Reverse transcription was performed using Superscript First Strand Synthesis System for RT–PCR kit (Invitrogen). Real-time PCR was performed with iQ supermix (Bio-Rad, Hercules, CA, USA) on a Bio-Rad iQ real-time PCR detection system (Bio-Rad). The primers and probes (Integrated DNA Technologies Inc., Coralville, IA, USA) for real-time PCR were as follows: GAPDH sense primer: CTCAACTACATGGTCTACATGTTCCA; GAPDH antisense primer: CCATTCTCGGCCTTGACTGT; GAPDH probe: TGACTCCACTCACGGCAAATTCAACG; transgenic IFN- (T-IFN) sense primer: GATATCTCGAGGAACTGGCAAAA; T-IFN antisense primer: CTTCAAAGAGTCTGAGGTAGAAAGAGATAAT; T-IFN probe: TGGTGACATGAAAATCCTGCAGAGCCA; major histocompatibility complex class I (MHC-I) sense primer: ATTCCCCAAAGGCCCATGT; MHC-I antisense primer: GTCTCCACAAGCTCCATGTCC; MHC-I probe: TGCTGGGCCCTGGGCTTCTACC; myelin basic protein (MBP) sense primer: GCTCCCTGCCCCAGAAGT; MBP antisense primer: TGTCACAATGTTCTTGAAGAAATGG; MBP probe: AGCACGGCCGGACCCAAGATG; proteolipid protein (PLP) sense primer: CACTTACAACTTCGCCGTCCT; PLP antisense primer: GGGAGTTTCTATGGGAGCTCAGA; PLP probe: AACTCATGGGCCGAGGCACCAA; ceramide galactosyltransferase (CGT) sense primer: TTATCGGAAATTCACAAGGATCAA; CGT antisense primer: TGGCGAAGAATGTAGTCTATCCAATA; CGT probe: CCGGCCACCCTGTCAATCGG; CAATT enhancer-binding protein homologous protein/growth and DNA damage protein 153 (CHOP/GADD153) sense primer: CCACCACACCTGAAAGCAGAA; CHOP antisense primer: AGGTGCCCCCAATTTCATCT; CHOP probe: TGAGTCCCTGCCTTTCACCTTGGAGA; binding immunoglobulin protein/78 kDa glucose regulated protein (BIP/GRP78) sense primer: ACTCCGGCGTGAGGTAGAAA; BIP antisense primer: AGAGCGGAACAGGTCCATGT; BIP probe: TTCTCAGAGACCCTTACTCGGGCCAAATT; tumour necrosis factor- (TNF-) sense primer: GGCAGGTTCTGTCCCTTTCA; TNF- antisense primer: ACCGCCTGGAGTTCTGGAA; TNF- probe: CCCAAGGCGCCACATCTCCCT; inducible nitric oxide synthase (iNOs) sense primer: GCTGGGCTGTACAAACCTTCC; iNOs antisense primer: TTGAGGTCTAAAGGCTCCGG; iNOs probe: TGTCCGAAGCAAACATCACATTCAGATCC; interleukin-2 (IL-2) sense primer: CTACAGCGGAAGCACAGCAG; IL-2 antisense primer: ATTTGAAGGTGAGCATCCTGGG; IL-2 probe: AGCAGCAGCAGCAGCAGCAGCA; IL-12 sense primer: CTCTATGGTCAGCGTTCCAACA; IL-12 antisense primer: GGAGGTAGCGTGATTGACACAT; IL-12 probe: CCTCACCCTCGGCATCCAGCAGC; IL-17 sense primer: ATGCTGTTGCTGCTGCTGAG; IL-17 antisense primer: TTTGGACACGCTGAGCTTTGAG; IL-17 probe: CGCTGCTGCCTTCACTGTAGCCGC; IL-23 sense primer: CTTCTCCGTTCCAAGATCCTTCG; IL-23 antisense primer: GGCACTAAGGGCTCAGTCAGA; IL-23 probe: TGCTGCTCCGTGGGCAAAGACCC.
Enzyme-linked immunosorbent assay (ELISA)
Mice were perfused with ice-cold PBS. The spinal cord and forebrain were removed and immediately homogenized in five volumes of PBS with complete protease cocktail (Roche, Indianapolis, IN, USA) using a motorized homogenizer. After incubation on ice for 5 min, the extracts were cleared by centrifugation at 14 000 r.p.m. for 10 min. The protein content of each extract was determined by the DC protein assay (Bio-Rad). ELISA assays were performed using Mouse IFN- Quantikine ELISA kit (R&D Systems, Minneapolis, MN, USA) following the manufacturer's instructions.
Immunohistochemistry
Anaesthetized mice were perfused through the left cardiac ventricle with 4% paraformaldehyde in 0.1 M PBS. The brains and spinal cord were removed, post-fixed with paraformaldehyde, cryopreserved in 30% sucrose, embedded in optimal cutting temperature (OCT) compound and frozen on dry ice. Frozen sections were cut in a cryostat at a thickness of 10 µm. For cuprizone-treated mice, coronal sections at the fornix region of the corpus callosum corresponding to Sidman sections 241–251 were selected for use, and all comparative analyses were restricted to mid-line corpus callosum (Sidman et al., 1971). For immunohistochemistry, frozen sections were treated with –20°C acetone, blocked with PBS containing 10% goat serum and 0.1% Triton X-100 and incubated overnight with the primary antibody diluted in blocking solution. Appropriate fluorochrome- or enzyme-labelled secondary antibodies (Vector Laboratories, Burlingame, CA, USA) were used for detection. Immunohistochemistry for CC1 (APC7, 1 : 50; EMD Biosciences, Inc., San Diego, CA, USA), MBP (1 : 1000; Sternberger Monoclonals, Lutherville, MD, USA), non-phosphorylated neurofilament-H (SMI32, 1 : 1000; Sternberger Monoclonals, Lutherville, MD, USA), CD3 (1 : 50, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and CD11b (1 : 50, Chemicon, Temecula, CA, USA), NG2 (1 : 50, Chemicon), phosphorylated eukaryotic translation initiation factor-2 (p-eIF-2, 1 : 50; Cell Signaling Technology, Beverly, MA, USA), and active caspase-3 (1 : 50, Cell Signaling Technology) was performed. Fluorescent stained sections were mounted with Vectashield mounting medium with 4',6-diamidino-2-phenylindole (DAPI; Vector Laboratories) and visualized with a Zeiss Axioplan fluorescence microscope. Images were captured using a Photometrics PXL CCD camera connected to an Apple Macintosh computer using the Open Lab software suite. We quantified immunopositive cells by counting positive cells within the median of the corpus callosum, confined to an area of 0.04 mm2. Only those cells with nuclei observable by DAPI staining were counted. We scored each MBP immunostaining slide on a scale of zero to four. A score of zero indicates complete demyelination, and a score of four indicates normal myelination in the corpus callosum of adult mice.
Toluidine blue staining and electron microscopy (EM)
Mice were anaesthetized and perfused with 0.1 M PBS containing 4% paraformaldehyde and 2.5% glutaraldehyde (pH 7.3). For EAE mice, the lumbar spinal cord was processed, embedded, sectioned and stained with toluidine blue as described previously (Coetzee et al., 1996). For cuprizone-treated mice, brains were sliced into 1 mm sections. The section corresponding to the region of the fornix was trimmed, processed for EM analysis and oriented so that a cross-section of the corpus callosum was achieved. Thin sections were cut, stained with uranyl acetate and lead citrate and analysed as described previously (Coetzee et al., 1996). We calculated the total percentage of remyelinated axons; a minimum of 300 fibres per mouse was analysed.
Western blot analysis
The corpus callosum from three mice were rinsed in ice-cold PBS and pooled, and immediately homogenized in 5 volumes of Triton X-100 buffer [20 mM HEPES (pH 7.5), 150 mM NaCl, 1% Triton X-100, 10% glycerol, 1 mM EDTA, 10 mM tetrasodium pyrophosphate, 100 mM NaF, 17.5 mM ß-glycerophosphate, 10 mM phenylmethylsulphonyl fluoride, 15 µg/ml aprotonin and 6 µg/ml pepstatin A] using a motorized homogenizer. After incubation on ice for 15 min, the extracts were cleared by centrifugation at 14 000 r.p.m. twice for 10 min each. The protein content of each extract was determined by protein assay (Bio-Rad). The extracts (40 µg) were separated by sodium dodecyl sulphate– polyacrylamide gel electrophoresis (SDS–PAGE) and transferred to nitrocellulose. The blots were incubated with primary antibody (see below), and the signal was revealed by chemiluminescence after reacting with horseradish peroxidase-conjugated second antibody. The following primary antibodies were used: anti-eIF-2 (1 : 500; Santa Cruz Biotechnology), anti-p-eIF-2 (1 : 1000, Cell Signaling Technology), anti-CHOP (1 : 500; Santa Cruz Biotechnology) and anti-actin (1 : 1000; Sigma, St Louis, MO, USA).
Statistics
Data are expressed as mean ± standard deviation. Multiple comparisons were statistically evaluated by one-way ANOVA (analysis of variance) test using Sigmastat 3.1 software (Hearne Scientific Software). Differences were considered statistically significant if P < 0.05.
|
Results |
|---|
|
TopSummaryIntroductionMaterial and methodsResultsDiscussionReferences |
|---|
CNS delivery of IFN-
suppresses remyelination, but not demyelination, in cuprizone-treated miceIn order to specifically assess the effects of IFN-
on remyelination, we used transgenic mice that allow for temporally regulated delivery of IFN- using the tetracycline controllable system (Lin et al., 2004). To drive tTA expression in astrocytes, these animals exploit the transcriptional regulatory region of the glial fibrillary acidic protein (GFAP) gene (Lin et al., 2004). GFAP/tTA mice were mated with TRE/IFN- mice to produce GFAP/tTA;TRE/IFN- double transgenic animals (Lin et al., 2004). Six-week-old double transgenic mice that had been maintained on doxycycline solution from conception were treated with 0.2% cuprizone chow for up to 6 weeks. Subsequently, mice were returned to a normal diet for up to 3 weeks to allow remyelination to occur. DOX+ double transgenic mice were GFAP/tTA;TRE/IFN- double transgenic animals fed cuprizone chow and never released from the doxycycline solution. In contrast, DOX– double transgenic mice were GFAP/tTA;TRE/IFN- double transgenic mice that were fed cuprizone chow and simultaneously switched to water. We examined IFN- expression in these animals by ELISA analysis, which showed that DOX+ double transgenic mice did not express IFN- in the forebrain for the duration of the study (Fig. 1A). DOX– double transgenic mice began expressing 
20 pg/mg of IFN- in the forebrain after 2 weeks of cuprizone treatment and removal of doxycycline. Real-time PCR analysis did not detect IFN- transgene expression as late as 12 days after the removal of doxycycline solution (data not shown). Moreover, real-time PCR analysis showed that the expression of MHC-1 was elevated in the corpus callosum of DOX+ double transgenic mice during cuprizone treatment and that the level decreased during remyelination. IFN- significantly increased the expression levels of MHC-I in DOX– double transgenic mice during the remyelination phase (Fig. 1B).
|
It is believed that oligodendrocytes are specifically insulted by cuprizone exposure and go through apoptosis in response to the neurotoxicant, which results in demyelination (Matsushima and Morell, 2001
). In accordance with previous studies (reviewed by Matsushima and Morell, 2001), we found that the majority of CC1 positive oligodendrocytes were lost in the corpus callosum of control DOX+ double transgenic mice after 2 weeks of cuprizone treatment (Fig. 2). CNS expression of IFN- after 2 weeks of cuprizone treatment (Fig. 1A) is thus unlikely to affect oligodendrocyte death induced by cuprizone exposure and the subsequent demyelination. Accordingly, we found that the majority of CC1 positive mature oligodendrocytes were lost within the lesion site in DOX– double transgenic mice after 2 weeks and 5 weeks of cuprizone treatment (Fig. 2). MBP immunohistochemical and EM analysis also revealed that demyelination in the corpus callosum of both DOX+ and DOX– double transgenic mice reached maximum levels (Fig. 3), where axons were essentially completely demyelinated (Fig. 4), after 5 weeks of cuprizone treatment.
|
|
|
We assessed remyelination by scoring MBP immunostained slides and calculating the total percentage of remyelinated axons through EM analysis. Remyelination in the corpus callosum of DOX+ double transgenic mice began at 6 weeks and became increasingly evident by 8 weeks, 2 weeks after cuprizone was removed from the diet (Fig. 3). In control mice, a large number of axons showed substantial recovery at 8 weeks (48.4% ± 4%, Fig. 4). Remyelination was markedly suppressed in the corpus callosum of DOX– double transgenic mice at 8 weeks (Fig. 3), with fewer remyelinated axons (26.9% ± 7%, Fig. 4). In addition, EM analyses showed that the presence of IFN-
in demyelinated lesions does not cause detectable axon damage (Fig. 4).
Previous studies have shown that the expression of myelin genes is upregulated during remyelination, and this early alteration in gene expression is believed to reflect an important step leading to the remyelination process (Morell et al., 1998; Jurevics et al., 2002). The upregulation of the myelin genes MBP, PLP and CGT became evident at 6 weeks, and reached peak levels at 8 weeks in the corpus callosum of the control mice (Fig. 5). In DOX– double transgenic mice myelin gene expression was significantly decreased at 6 weeks and at 8 weeks. Thus, these data further confirm that the presence of IFN- in demyelinated lesions suppresses remyelination.
|
Following cuprizone-induced demyelination, oligodendrocyte precursors (OPCs) repopulate the corpus callosum and differentiate into oligodendrocytes, which are responsible for remyelinating the demyelinated lesions (Mason et al., 2000
; Matsushima and Morell, 2001). After 6 weeks of cuprizone exposure, the CC1 positive oligodendrocytes began to reappear (42.5 ± 2.1/0.04 mm2) within the demyelinated corpus callosum of control mice and reached 228.7 ± 20.2/0.04 mm2 at 8 weeks (Fig. 4). In the DOX– double transgenic animals there was a dramatic reduction in the number of CC1 positive oligodendrocytes within the corpus callosum at 8 weeks (78 ± 12.7/0.04 mm2, Fig. 4). These data suggest that the reduction of CC1 positive oligodendrocytes elicited by IFN- contributes to the poor remyelination of demyelinated lesions in the presence of this cytokine.
Previous studies have shown that CC1 positive oligodendrocytes are derived from NG2 positive OPCs (Watanabe et al., 1998; Mason et al., 2000). In control mice, NG2 positive OPCs accumulated within the demyelinated corpus callosum between 5 weeks and 6 weeks of cuprizone exposure, then declined in number during the reappearance of mature oligodendrocytes and remyelination (Fig. 6). The presence of IFN- significantly increased NG2 positive OPCs in the corpus callosum at 4 weeks of cuprizone treatment (46 ± 4.24 versus 19 ± 2.12/0.04 mm2, P < 0.05), but fewer NG2 positive OPCs were observed in demyelinated lesions of DOX– double transgenic mice at 6 weeks (31.5 ± 0.71 versus 80 ± 2.8/0.04 mm2, P < 0.05). The number of NG2 positive OPCs was comparable in the DOX+ and DOX– animals at 7 and 8 weeks. Thus, the presence of IFN- altered the time course of NG2 positive OPCs recruitment into the demyelinated lesions but did not reduce the overall OPC numbers in cuprizone-treated mice during the remyelination period.
|
CNS delivery of IFN-
at the recovery stage of EAE inhibited remyelinationWe next examined the effects of IFN-
on remyelination in EAE, an immune-mediated animal model of multiple sclerosis. Six-week-old female GFAP/tTA;TRE/IFN- double transgenic mice that had been maintained on doxycycline solution from conception to suppress the transcriptional activating function of tTA were immunized with MOG 35–55 peptide and never released from doxycycline solution (control mice) or released from doxycycline solution at post-immunization day 7 (PID 7). ELISA analysis showed that the level of IFN- protein in the spinal cord of the two groups of mice at the peak of disease (PID 17) is not significantly different, 60 pg/mg; however, the levels of IFN- in the mice released from doxycycline were significantly higher than in the control mice at the recovery stage of EAE (PID 50, Table 1). Moreover, real-time PCR analysis revealed that mRNA for transgenic IFN- could be detected in the spinal cord of double transgenic mice released from doxycycline at PID 7 as early as PID 21 (data not shown), which is consistent with the time course of transgene induction observed in the cuprizone studies (Fig. 1A and data not shown). Consistent with this observed lag in IFN- transgene induction, control mice and the mice released from doxycycline displayed the clinical course of typical EAE at disease onset and the peak of disease (Fig. 7). Control mice all started recovering from EAE around PID 21, and the majority of these mice became almost indistinguishable from naïve mice by about PID 50. In contrast, double transgenic mice released from doxycycline at PID 7 showed signs of a prolonged disease course. Approximately 50% of the mice that developed hind limb paralysis at the peak of disease showed continuous hind limb paralysis at PID 50 (Table 1). These data suggest that CNS delivery of IFN- at the recovery stage of EAE delays disease recovery.
|
|
To determine the role of IFN-
in remyelination, the spinal cord of MOG-immunized animals was prepared and analysed at PID 50. Immunostaining for MBP was notably reduced in the lumbar spinal cord of double transgenic mice released from doxycycline at PID 7 compared with control mice (Fig. 8A and B). Toluidine blue staining revealed that a large number of axons in the lumbar spinal cord of mice overexpressing IFN- were unmyelinated. In contrast, control mice displayed very few unmyelinated axons at this time point (Fig. 8C and D). Furthermore, CNS expression of IFN- at the recovery stage of EAE significantly reduced CC1 positive oligodendrocyte numbers in lumbar spinal cord at PID 50 (Fig. 8E and F). On the other hand, we found that CNS delivery of IFN- did not significantly affect the axonal damage identified by non-phosphorylated neurofilament-H immunostaining at the recovery stage of EAE (Fig. 8G and H). Collectively, these data indicate that the remyelination failure elicited by IFN- contributed to the poor recovery of the double transgenic mice released from doxycycline at PID 7.
|
IFN-
possesses numerous immunomodulatory effects, including the induction of MHC antigens and the activation of macrophages and T-lymphocytes. We next examined the effects of IFN- on the CNS immune response during remyelination. CD3 and CD11b immunostaining showed that elevated levels of IFN- in the CNS did not significantly change the numbers of infiltrating T cells and macrophages present in the demyelinated lesions (Fig. 9A–D). Real-time PCR analysis, however, revealed that the elevated IFN- levels in the spinal cord of mice released from doxycycline at PID 7 led to increased expression of MHC-I, TNF-, IL-2 and IL-12 and decreased expression of IL-17, and did not significantly affect the expression of iNOs and IL-23 (Fig. 9E). These data suggest that CNS delivery of IFN- at the recovery stage of EAE modestly enhances the immune responses in the demyelinated lesions, which might contribute to the remyelination failure elicited by this cytokine.
|
The detrimental effect of IFN-
on remyelination is associated with ER stressOligodendrocytes have been shown to be highly sensitive to disruption of protein synthesis and perturbation of the secretory pathway (Leegwater et al., 2001
; Southwood et al., 2002). Recently, we reported that the hypomyelination induced by IFN- during development was associated with ER stress in myelinating oligodendrocytes (Lin et al., 2005). To determine whether IFN- interferes with ER function in remyelinating oligodendrocytes, we monitored the expression of ER stress markers in the corpus callosum of cuprizone-treated mice. The levels of mRNA encoding BIP and CHOP, both of which are associated with the ER stress response, were increased 2-fold in the corpus callosum of DOX– double transgenic mice compared with control animals (Fig. 10A and B). Elevated levels of the CHOP protein, 1.7-fold, were also observed in the corpus callosum of DOX– double transgenic mice by western blot analysis (Fig. 10C). The phosphorylation of eIF-2, which inhibits nucleotide exchange on the eIF-2 complex and attenuates most protein synthesis, occurs within minutes following the development of ER stress (Ron, 2002). Western blot analysis revealed that IFN- elevated the level of phosphorylated eIF-2 1.8-fold in the corpus callosum (Fig. 10C). Furthermore, colocalization analysis with the CC1 antibody revealed that remyelinating oligodendrocytes displayed increased levels of p-eIF-2 (Fig. 10D and E). These results indicate that the detrimental effect of IFN- on remyelination is associated with the activation of the ER stress pathway.
|
We next pursued a genetic approach to examine the involvement of the ER stress response in the remyelination failure elicited by IFN-
. We have demonstrated that enforced expression of IFN- in mice heterozygous for a loss of function mutation in PERK dramatically reduces animal survival, promotes CNS hypomyelination and enhances oligodendrocyte loss compared with wild-type mice (Lin et al., 2005). Thus, to examine the influence of the ER stress response on the remyelination failure elicited by IFN-, we crossed TRE/IFN- mice with PERK+/– mice (Harding et al., 2001), and then crossed the resulting progeny with GFAP/tTA mice to obtain double transgenic mice heterozygous for the PERK mutation. Six-week-old GFAP/tTA; TRE/IFN- double transgenic mice on a PERK+/– background that had been maintained on doxycycline solution from conception were simultaneously treated with 0.2% cuprizone and released from doxycycline solution. CC1 immunohistochemistry and EM analysis revealed that a loss of function mutation in PERK did not affect the demyelination process during cuprizone treatment (data not shown). In contrast, GFAP/tTA;TRE/IFN-;PERK+/– mice that were released from doxycycline at the time of cuprizone exposure display significantly fewer remyelinated axons at 9 weeks (15.6% ± 7.6%, Fig. 11), 3 weeks after cuprizone was removed from the diet, compared with double transgenic mice on a PERK+/+ background (31.1% ± 7.6%). Animals that were maintained continuously on doxycycline to repress IFN- expression had significantly more remyelinated axons (54.0%).
|
To gain insight into the cellular mechanisms that account for the remyelination failure displayed by PERK+/– mice expressing IFN-
in the CNS, we next examined oligodendrocyte numbers in the corpus callosum of these mice. Compared with double transgenic mice on a PERK+/+ background released from doxycycline at the time of cuprizone exposure, which already showed significantly decreased oligodendrocyte numbers at 9 weeks (123.2 ± 27.5/0.04 mm2 versus 283.2 ± 27.7/0.04 mm2, P < 0.01; Fig. 12A and B), very few oligodendrocytes could be detected in the corpus callosum of double transgenic mice on a PERK+/– background (73.2 ± 17.6/0.04 mm2). In addition, the number of oligodendrocytes that were positive for active-caspase-3 in the corpus callosum of the mice released from doxycycline at the time of cuprizone exposure was 2.3 times higher than the number of such cells in double transgenic mice on a wild-type background (Fig. 12C). The reduction of remyelinating oligodendrocytes was highly correlated with remyelination failure elicited by IFN- in the corpus callosum of the mice on the PERK+/– background. These data reinforce the hypothesis that the ER stress response is associated with remyelination failure and reduction of oligodendrocyte numbers elicited by IFN- in the cuprizone-induced demyelination model and indicate that PERK is essential for remyelinating oligodendrocyte survival during ER stress.
|
|
Discussion |
|---|
|
TopSummaryIntroductionMaterial and methodsResultsDiscussionReferences |
|---|
IFN-
is known to be present in multiple sclerosis demyelinated lesions (Panitch, 1992; Vartanian et al., 1995; Mycko et al., 2003). Nevertheless, the consequence of this presence has been difficult to elucidate. To gain a clearer understanding of the effects of this cytokine on the remyelination processes, we have exploited a genetic approach. By combining transgenic animals that express IFN- in the CNS in a temporally controllable manner with the well-characterized cuprizone and EAE models of demyelination/remyelination, we have been able to focus our analysis of the effects of this cytokine specifically on the remyelination process and to initiate a characterization of the underlying mechanisms.
In a previous study, we have shown that transgenic mice that express IFN- under the transcriptional control of the MBP gene (MBP/IFN- mice) are resistant to cuprizone-induced demyelination (Gao et al., 2000). MBP/IFN- mice express the cytokine in oligodendrocytes throughout development and into adulthood. In the present study, we have used a transgenic mouse system in which IFN- expression is targeted at astrocytes and is regulated by doxycycline. During development, IFN- expression is efficiently repressed in these animals. When expression of IFN- is induced at a time point when the majority of oligodendrocytes have been lost, the severity of cuprizone-induced demyelination is not affected, indicating that the protection previously observed in the MBP/IFN- mice (Gao et al., 2000) requires the presence of the IFN- before oligodendrocyte death. Secondly, the expression of IFN- at the time of maximum oligodendrocyte loss resulted in a severely repressed remyelination response.
Similarly, we demonstrate that CNS expression of IFN- at the recovery stage of EAE does not affect the initial aspects of the disorder but does delay disease recovery and inhibits CNS remyelination. Contradictory experimental data also exist concerning the role of IFN- in the EAE model. Mice with a mutation in either the gene encoding IFN- or its receptor remain susceptible to EAE and in fact develop EAE with higher morbidity and mortality (Ferber et al., 1996; Willenborg et al., 1996). In addition, in preliminary studies we have found that CNS delivery of IFN- prior to demyelination protects C57BL/6 mice from EAE-induced demyelination (W. Lin and B. Popko, unpublished data). Taken together, these data indicate that the presence of IFN- in the CNS may protect against demyelination, but may inhibit remyelination. Thus, the effects of IFN- in demyelinating disorders, harmful or helpful, may be dependent on its temporal expression pattern at the lesion site. The availability of the IFN- inducible model described here will allow us to pursue this issue in more detail.
Evidence is accumulating that the principal cellular mechanisms of remyelination may differ with developmental myelination (Franklin, 2002; Arnett et al., 2004; Stidworthy et al., 2004; Balabanov and Popko, 2005). Consistent with this is the current observation that remyelinating oligodendrocytes derived from adult OPCs in demyelinated lesions appear more vulnerable to IFN- insult compared with developing oligodendrocytes. We show that the presence of very low doses of IFN-, 20 pg/mg in the forebrain of cuprizone-treated mice and 40 pg/mg in the spinal cord of EAE mice, dramatically reduces the reappearance of the oligodendrocyte population in demyelinated lesions. In contrast, we have previously demonstrated that the presence of approximately 45 pg/mg of IFN- in the CNS of developing transgenic mice does not significantly affect oligodendrocyte development (Baerwald et al., 2000; Gao et al., 2000; unpublished data), and that the presence of 200 pg/mg of IFN- in the CNS of developing mice is capable of stimulating ER stress in myelinating oligodendrocytes but only moderately reduces oligodendrocyte numbers (Lin et al., 2005; unpublished data). Moreover, oligodendrocytes from adult mice are resistant to the presence of 200 pg/ml of IFN- (Lin et al., 2005). Thus, together these data suggest that remyelinating oligodendrocytes are more sensitive to the deleterious effects of IFN- than are developing or mature oligodendrocytes.
A major challenge in multiple sclerosis research is to understand the cause of remyelination failure and to devise ways of ameliorating its consequences. In recent years, several lines of evidence have suggested that the demyelinated lesions in multiple sclerosis are not deficient in OPCs, rather that remyelination failure is associated with the insufficient repopulation of oligodendrocytes (Lucchinetti et al., 1999; Chang et al., 2000; Maeda et al., 2001). Moreover, a recent study suggests that OPCs are less sensitive to the apoptotic-inducing effects of IFN- than are actively myelinating oligodendrocytes (Chew et al., 2005). We have demonstrated that 70 U/ml IFN- is able to induce apoptosis in cultured rat oligodendrocytes that are actively synthesizing myelin components (Lin et al., 2005). In contrast, Chew et al. (2005) show that similar amounts of IFN- actually promote OPC proliferation in purified rat cultures. Consistent with these in vitro observations, we show here that CNS delivery of IFN- does not significantly reduce the overall OPC numbers in demyelinated lesions, but that the number of mature, remyelinating oligodendrocytes is reduced. It is clear that T-cells and IFN- are present within multiple sclerosis demyelinated lesions (Panitch, 1992; Vartanian et al., 1995; Mycko et al., 2003) therefore, the hypersensitivity of remyelinating oligodendrocytes to IFN- could be a major contributing factor to poor remyelination in individuals with multiple sclerosis. Efforts to reduce the deleterious effects of IFN- in demyelinated lesions would thus probably prove therapeutically beneficial.
We have also found that the detrimental effect of IFN- on the remyelination process in the cuprizone model is associated with an activated ER stress response in oligodendrocytes, and Chakrabarty et al. (2004) have similarly presented evidence for an oligodendroglial stress response in mice experiencing EAE. Furthermore, we have used a genetic approach to show that the ability of remyelinating oligodendrocytes to respond to ER stress modulates the harmful actions of IFN- on the remyelination process in the cuprizone model. Therefore, the response of remyelinating oligodendrocytes to ER stress might significantly contribute to remyelination failure. The harmful effects of ER stress might contribute to the death of remyelinating oligodendrocytes, as well as to the paucity of new myelin formed by the surviving oligodendrocytes. Therefore, therapeutic efforts to alleviate this stress could prove beneficial in enhancing myelin repair in multiple sclerosis patients. Nevertheless, the underlying molecular mechanism that sensitizes remyelinating oligodendrocytes to ER stress elicited by IFN- requires further investigation. Previous studies have shown that the accumulation of MHC-I heavy chain molecules in the ER of oligodendrocytes results in myelin abnormalities in MBP/MHC-I transgenic mice and that IFN- exacerbated their phenotype (Baerwald et al., 2000). We have also shown that IFN- significantly increases the expression of MHC-I in cultured oligodendrocytes (Baerwald and Popko, 1998; Lin et al., 2005) and in the cuprizone-induced lesions, particularly during the remyelination phase (Fig. 1B). Remyelinating oligodendrocytes are responsible for the synthesis and processing of enormous amounts of membrane lipid and protein molecules through the secretory pathway, such that under normal conditions these cells may be close to an ER stress threshold. It is possible that the added expression of MHC proteins, along with other IFN--induced membrane and secreted proteins (K. Strand and B. Popko, unpublished observations), contributes to the ER load of remyelinating oligodendrocytes to the extent that the cells are driven to the stressed state. Alternatively, or additionally, inflammatory molecules such as NO and IL-1ß, which have been shown to activate the ER stress pathway (Kawahara et al., 2001; Oyadomari et al., 2001; Cardozo et al., 2005), may contribute to the ER stress of oligodendrocytes in the presence of IFN-.
An alternative possibility is that IFN- suppresses remyelination through the activation of macrophages. It is clear that activated microglia/macrophages play a significant role in oligodendroglial and myelin damage in multiple sclerosis and EAE, both as direct effector cells and through the secretion of TNF- and reactive oxygen intermediates (Diemel et al., 1998; Trapp et al., 1999; Hemmer et al., 2002). The modest activation of macrophages with an upregulation of TNF- but not iNOs was observed in demyelinated lesions of mice overexpressing IFN- in the EAE and cuprizone models (data not shown). The degree to which the presence of an increased macrophage response in the lesion site contributes to the inhibition of the remyelination response in our animal models remains to be determined.
While axonal degeneration is believed to be a major determinant of irreversible neurological disability in multiple sclerosis patients, the roles of proinflammatory cytokines in axonal damage are poorly understood (Bjartmar et al., 2003). We find that the presence of IFN- does not increase axonal degeneration in the demyelinated lesions of cuprizone-treated mice. Moreover, we show that CNS delivery of IFN- is not sufficient to cause axon damage at the recovery stage of EAE, which is consistent with a previous report (Gimsa et al., 2000). Thus, there is little evidence to suggest that IFN- is a major determining factor involved in axonal degeneration in multiple sclerosis.
In summary, the IFN- inducible model described here has allowed us to begin to specifically examine the effect of this cytokine on the remyelination processes in a temporally controlled manner. These studies have demonstrated that the presence of IFN- in the lesion site has a severe, detrimental effect on the remyelination process. Moreover, we have used a genetic approach to show that the detrimental effect is mediated, at least partly, through ER stress. These studies have significant implications with regard to therapeutic approaches to myelin repair.
|
Acknowledgements |
|---|
This work was supported by grants to B.P. from the National Institutes of Health (NS34939), the National Multiple Sclerosis Society (RG 3291 A4/T) and the Myelin Repair Foundation and by NIH grants DK47119 and ES08681 to D.R. J.L.D. is the recipient of a Wadsworth Foundation Young Investigator Research Award. The authors acknowledge the helpful contribution of discussions with colleagues at the Myelin Repair Foundation. We are also indebted to Krystal Strand for critically reading the manuscript.
|
References |
|---|
|
TopSummaryIntroductionMaterial and methodsResultsDiscussionReferences |
|---|
Arnett HA, Fancy SP, Alberta JA, Zhao C, Plant SR, Kaing S, et al. bHLH transcription factor Olig1 is required to repair demyelinated lesions in the CNS. Science 2004; 306: 2111–5.
Baerwald KD, Popko B. Developing and mature oligodendrocytes respond differently to the immune cytokine interferon-gamma. J Neurosci Res 1998; 52: 230–9.[CrossRef][ISI][Medline]
Baerwald KD, Corbin JG, Popko B. Major histocompatibility complex heavy chain accumulation in the endoplasmic reticulum of oligodendrocytes results in myelin abnormalities. J Neurosci Res 2000; 59: 160–9.[CrossRef][ISI][Medline]
Balabanov R, Popko B. Myelin repair: developmental myelination redux? [Review]. Nat Neurosci 2005; 8: 262–4.[CrossRef][ISI][Medline]
Bjartmar C, Wujek JR, Trapp BD. Axonal loss in the pathology of MS: consequences for understanding the progressive phase of the disease. [Review]. J Neurol Sci 2003; 206: 165–71.[CrossRef][ISI][Medline]
Bruck W, Kuhlmann T, Stadelmann C. Remyelination in multiple sclerosis. [Review]. J Neurol Sci 2003; 206: 181–5.[CrossRef][ISI][Medline]
Cardozo AK, Ortis F, Storling J, Feng YM, Rasschaert J, Tonnesen M, et al. Cytokines downregulate the sarcoendoplasmic reticulum pump Ca2+ ATPase 2b and deplete endoplasmic reticulum Ca2+, leading to induction of endoplasmic reticulum stress in pancreatic beta-cells. Diabetes 2005; 54: 452–61.
Chakrabarty A, Danley MM, LeVine SM. Immunohistochemical localization of phosphorylated protein kinase R and phosphorylated eukaryotic initiation factor-2 alpha in the central nervous system of SJL mice with experimental allergic encephalomyelitis. J Neurosci Res 2004; 76: 822–33.[CrossRef][ISI][Medline]
Chang A, Nishiyama A, Peterson J, Prineas J, Trapp BD. NG2-positive oligodendrocyte progenitor cells in adult human brain and multiple sclerosis lesions. J Neurosci 2000; 20: 6404–12.
Chew LJ, King WC, Kennedy A, Gallo V. Interferon-gamma inhibits cell cycle exit in differentiating oligodendrocyte progenitor cells. Glia 2005; 52: 127–43.[CrossRef][ISI][Medline]
Coetzee T, Fujita N, Dupree J, Shi R, Blight A, Suzuki K, et al. Myelination in the absence of galactocerebroside and sulfatide: normal structure with abnormal function and regional instability. Cell 1996; 86: 209–19.[CrossRef][ISI][Medline]
Compston A, Coles A. Multiple sclerosis. [Review]. Lancet 2002; 359: 1221–31.[CrossRef][ISI][Medline]
Corbin JG, Kelly D, Rath EM, Baerwald KD, Suzuki K, Popko B. Targeted CNS expression of interferon-gamma in transgenic mice leads to hypomyelination, reactive gliosis, and abnormal cerebellar development. Mol Cell Neurosci 1996; 7: 354–70.[CrossRef][ISI][Medline]
Diemel LT, Copelman CA, Cuzner ML. Macrophages in CNS remyelination: friend or foe? [Review]. Neurochem Res 1998; 23: 341–7.[CrossRef][ISI][Medline]
Ferber IA, Brocke S, Taylor-Edwards C, Ridgway W, Dinisco C, Steinman L, et al. Mice with a disrupted IFN-gamma gene are susceptible to the induction of experimental autoimmune encephalomyelitis (EAE). J Immunol 1996; 156: 5–7.[Abstract]
Franklin RJ. Why does remyelination fail in multiple sclerosis? (Review). Nat Rev Neurosci 2002; 3: 705–14.[CrossRef][ISI][Medline]
Gao X, Gillig TA, Ye P, D'Ercole AJ, Matsushima GK, Popko B. Interferon-gamma protects against cuprizone-induced demyelination. Mol Cell Neurosci 2000; 16: 338–49.[CrossRef][ISI][Medline]
Gimsa U, Peter SV, Lehmann K, Bechmann I, Nitsch R. Axonal damage induced by invading T cells in organotypic central nervous system tissue in vitro: involvement of microglial cells. Brain Pathol 2000; 10: 365–77.[ISI][Medline]
Harding HP, Zeng H, Zhang Y, Jungries R, Chung P, Plesken H, et al. Diabetes mellitus and exocrine pancreatic dysfunction in perk–/– mice reveals a role for translational control in secretory cell survival. Mol Cell 2001; 7: 1153–63.[CrossRef][ISI][Medline]
Hemmer B, Archelos JJ, Hartung HP. New concepts in the immunopathogenesis of multiple sclerosis. [Review]. Nat Rev Neurosci 2002; 3: 291–301.[CrossRef][ISI][Medline]