Brain Advance Access originally published online on February 14, 2007
Brain 2007 130(3):862-874; doi:10.1093/brain/awl389
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SUCLA2 mutations are associated with mild methylmalonic aciduria, Leigh-like encephalomyopathy, dystonia and deafness

1Unit of Molecular Medicine, 2Division of Metabolism, Bambino Gesù Children's Hospital, Rome, Italy, 3Department of Occupational and Public Health, Torshavn, Faroe Islands, 4Department of Pediatrics and Genetics, 5Laboratory of Pediatrics and Neurology, Radboud University, Nijmegen Medical Centre, Nijmegen, The Netherlands and 6Molecular Genetics Laboratory, University Children's Hospital, Hamburg, Germany
Corresponding author: Carlo Dionisi-Vici, Division of Metabolism, Bambino Gesù Children's Hospital, Piazza S. Onofrio 4, 00165 Rome, Italy; Ron A. Wevers, Radboud University Nijmegen Medical Centre, Laboratory of Pediatrics and Neurology, P.O. Box 9101, 6500 HB Nijmegen, The Netherlands E-mail: dionisi{at}opbg.net; r.wevers{at}cukz.umcn.nl
| Summary |
|---|
|
|
|---|
One pedigree with four patients has been recently described with mitochondrial DNA depletion and mutation in SUCLA2 gene leading to succinyl-CoA synthase deficiency. Patients had a Leigh-like encephalomyopathy and deafness but besides the presence of lactic acidosis, the profile of urine organic acid was not reported.
We have studied 14 patients with mild unlabelled methylmalonic aciduria (MMA) from 11 families. Eight of the families are from the Faroe Islands, having a common ancestor, and three are from southern Italy. Since the reaction catalysed by succinyl-CoA synthase in the tricarboxylic acid (TCA) cycle represents a distal step of the methylmalonic acid pathway, we investigated the SUCLA2 gene as a candidate gene in our patients. Genetic analysis of the gene in the 14 patients confirmed the defect in all patients and led to the identification of three novel mutations (p.Gly118Arg; p.Arg284Cys; c.534 + 1G
A). The defect could be convincingly shown at the protein level and our data also confirm the previously described mitochondrial DNA depletion. Defects in SUCLA2 can be found at the metabolite level and are defined by mildly elevated methylmalonic acid and C4-dicarboxylic carnitine concentrations in body fluids in association with variable lactic acidosis. Clinically the diagnosis should be considered in patients with early/neonatal onset encephalomyopathy, dystonia, deafness and Leigh-like MRI abnormalities mainly affecting the putamen and the caudate nuclei. The frequency of the mutated allele in the Faroese population amounted to 2%, corresponding with an estimated homozygote frequency of 1 : 2500. Our data extend knowledge on the genetic defects causing MMA. Our patients present with an early infantile Leigh-like encephalomyopathy with deafness, and later on a progressive dystonia. Mild MMA, lactic acidosis and specific abnormalities in the carnitine ester profile are the biochemical hallmarks of the disease. In view of the frequency of the mutated allele on the Faroe Islands, measures become feasible to prevent the occurrence of the disease on the islands. We confirm and extend the findings on this inborn error of metabolism in the TCA cycle that must be carefully investigated by accurate metabolite analyses.
Key Words: methylmalonic aciduria; succinylcarnitine; mtDNA depletion; succinyl-CoA synthetase; TCA cycle defect
Abbreviations: MIM, Mendelian Inheritance in Man database; MMA, methylmalonic aciduria; mtDNA, mitochondrial DNA; SCS-A, ADP-forming succinyl-CoA synthetase; SCS-G, GDP-forming succinyl-CoA synthetase; SUCLA2, gene coding for the ß-subunit of ADP-forming succinyl-CoA synthetase; TCA, tricarboxylic acid; GCMS, gas chromatography/mass spectrometry; MSMS, tandem mass spectrometry
.
Received September 22, 2006. Revised November 26, 2006. Accepted December 20, 2006.
| Introduction |
|---|
|
|
|---|
Methylmalonic aciduria (MMA) is one of the most frequent forms of branched-chain organic acidurias, a class of diseases caused by enzymatic defects involved in the catabolism of branched-chain amino acids valine and isoleucine and of other propiogenic substrates such as methionine, threonine, odd-chain fatty acids and cholesterol. MMAs encompass a group of genetically heterogeneous autosomal recessive disorders of methylmalonate and cobalamin metabolism caused by a defect in the conversion of methylmalonyl-CoA to succinyl-CoA (Deodato et al., 2006
In most cases the onset of the disease is in the neonatal period with recurrent vomiting, dehydration, respiratory distress, hypotonia, progressive lethargy, seizures and coma, leading to death if not promptly treated. In the later-onset form, the clinical picture is more variable, ranging from acute life-threatening encephalopathy to intermittent or chronic symptoms of various degrees. The classical form caused by apoenzyme mutations is indistinguishable from the two variants due to defects in adenosylcobalamin formation; however, the long-term prognosis is less severe in co-enzyme defects because of vitamin B12 responsiveness. The neurological picture in patients with MMA is frequently characterized by an acute and progressive dystonic syndrome resulting from basal ganglia lesions. These are localized bilaterally in the globus pallidus and usually occur following acute episodes of metabolic decompensation.
Increased levels of methylmalonic acid can also be observed in MMA with homocystinuria, caused by other defects of cobalamin metabolism (cblC, MIM 277400
[OMIM]
, and cblD, MIM 277410
[OMIM]
) which impair the conversion of vitamin B12 into its two metabolically active forms, methylcobalamin and adenosylcobalamin. However, these forms present with a different clinical and brain MRI phenotype (Longo et al., 2005
). Very recently, a new genetic defect caused by mutation in the methylmalonyl-CoA epimerase gene has been reported in patients with mild MMA (MIM 251120
[OMIM]
) (Bikker et al., 2006
; Dobson et al., 2006
).
Besides these clinically, biochemically and genetically well-defined conditions, there are a few reports describing unlabelled MMA cases, presenting with progressive encephalopathy, bilateral symmetric lesions of basal ganglia and mild urinary excretion of methylmalonic acid (Stromme et al., 1995
; Mayatepek et al., 1996
; Deodato et al., 2005
). In these cases, all known forms of MMA were excluded, suggesting a hitherto unrecognized metabolic disorder(s). Furthermore, mild MMA has been reported in two unrelated infants with cortical atrophy of the frontal lobes, metabolic acidosis and mitochondrial DNA depletion (Yano et al., 2003
).
Recently, mutations in the gene encoding the ß-subunit of the ADP-forming succinyl-CoA synthetase (SCS-A; MIM 603921
[OMIM]
; EC 6.2.1.5
[EC]
) (SUCLA2) have been reported in an inbred family in whom two patients had mitochondrial DNA depletion in association with a Leigh-like encephalomyopathy. Besides the presence of lactic acidosis, the profile of urine organic acid in those children was not reported (Elpeleg et al., 2005
). Succinyl-CoA synthetase catalyses the reversible synthesis of succinate and ATP from succinyl-CoA and ADP in the tricarboxylic acid (TCA) cycle (Fig. 1).
|
This reaction that represents a distal step of the methylmalonic acid pathway, led us to investigate the SUCLA2 gene in a series of patients with unlabelled MMA presenting clinical similarities with the patients described by Elpeleg et al. (2005
| Material and methods |
|---|
|
|
|---|
Subjects
We selected three patients from three southern Italian families (mother of patient 2 is from Romania), and 11 patients from an inbred kinship in the Faroe Islands where common ancestors could be traced back to the period 163050. For privacy reasons a simplified family tree is shown (Fig. 2). The 11 Faroese patients are from eight families with three families having two affected children. Genome scanning was performed in this pedigree. In addition, we also reviewed the literature of other unlabelled MMA and analysed six patients previously described [Stromme et al., 1995
|
Patient 1
This is the third child of healthy parents coming from a small village in southern Italy. The family history is unremarkable. The patient was born at term by normal delivery after an uneventful pregnancy with a birth weight of 3.5 kg. Since the first months of life retardation of gross motor development and severe axial hypotonia were observed. Feeding problems and gastroesophageal reflux were noted from the first weeks of life. At the age of 8 months he was hospitalized for evaluation. Length, weight and head circumference ranged between 50th and 75th percentile. There was axial hypotonia, no head control, poor spontaneous movements, and deep tendon reflexes were difficult to elicit. The child was alert and able to smile, and grossly his mental capacity was better than his motor function. Electroencephalography (EEG), nerve conduction velocity (NCV), fundoscopy and visual evoked potentials (VEP) were normal, while brainstem auditory evoked potentials (BAEP) revealed neurosensorial deafness. Routine laboratory investigations showed metabolic acidosis and increased blood lactate (46 mmol/l, normal <2). Ammonia, amino acids, total homocysteine, folates and vitamin B12 were normal in blood. At short-term follow-up gross motor dysfunction persisted, while intermittent dystonic movements of the arms started to appear at the age of 1 year.
Patient 2
This child is the second born from non-consanguineous healthy parents; the father is from southern Italy and the mother from Romania. His eldest sister is healthy. Pregnancy and delivery (Apgar score 8/9) were uneventful. At birth, length, weight and head circumference were normal. Delayed motor milestones and failure to thrive were noticed from the age of 4 months. Thereafter, the child has never been able to sit alone, and when evaluated at age 14 months he was alert, was able to control his head but did not sit on his own because of axial hypotonia and weakness, and had no rolling when laid supine. He was able to catch an object and bring it to his mouth without dystonic posturing. Laboratory investigations showed increased blood lactate (7.5 mmol/l, normal <2). Ammonia, amino acids, total homocysteine, folates and vitamin B12 were normal in blood.
Patient 3
This patient is distantly related to patient 2: his mother is a second-degree cousin of the father of patient 2, the proband is the second born and his elder sister is apparently well. Delayed motor milestones and failure to thrive were noticed from the fourth month of life. At the age of 3 years the child was alert and able to smile, he presented poor growth, axial hypotonia, dystonic movements and weak tendon reflexes. BAEP revealed neurosensorial deafness. Laboratory investigations showed increased blood lactate (3.0 mmol/l, normal <2). Ammonia, amino acids, total homocysteine, folates and vitamin B12 were normal in blood.
Patients 414
The 11 probands were born to healthy parents from eight related families after uneventful pregnancies; two were born by Caesarian section. No dysmorphic features were present at birth. Feeding problems were noted mostly from the neonatal period, leading to failure to thrive. The children also suffered from recurrent upper respiratory infections becoming less apparent after school-age. The patients had a severe muscle hypotonia with progressive areflexia. There was a profound motor developmental delay, none of the patients learned to sit or stand without support. No speech development was observed but the children learned to understand sign language. Due to the progressive dystonia the slow motor development arrested with a progressive neurological deterioration from the age of 1214 months. The patients developed a hyperkineticdystonic movement disorder and external ophthalmoplegia and/or ptosis. Divergent strabismus occurred later in the course of the disease after the age of 1 year. All patients were diagnosed with profound neurosensorial deafness as detected by BAEP studies. Three received a cochlear implant with improvement in their communication. After the implant they were able to understand spoken language. Two had a progressive axonal and demyelinating polyneuropathy, especially of the lower limbs, confirmed by nerve conduction studies. One had epilepsy, one had a very mild restrictive cardiomyopathy and one a renal tubular dysfunction with features of Fanconi syndrome. Six patients died in the paediatric age and one in young adulthood due to intercurrent infections. Eight of the eleven patients had a CT-scan or MRI or both.
Biochemical and molecular analyses
Urine organic acids and plasma acylcarnitines were analysed according to standard methods. Briefly, organic acids were analysed by gas chromatography/mass spectrometry (GCMS) after extraction with ethyl acetate and derivatization with N,N-bis(trimethylsilyl)trifluoracetamide containing 1% trimethylchlorosilane. Acylcarnitine esters were measured by tandem mass spectrometry (MSMS) after butylation, essentially as previously described (Vreken et al., 1999
; Rizzo et al., 2003
). Methylmalonic acid in plasma was measured by liquid chromatography MSMS. Briefly, 100 µl of body fluid was mixed with deuterated stable isotope-labelled methylmalonic acid (to counter effect any matrix and ion suppression effects), and deproteinized with an ultracentrifugation tube (molecular mass cutoff: 30 kDa). An acidified aliquot was injected onto a C18 column for chromatographic separation of methylmalonic acid and succinic acid. The MSMS was operated in negative multiple reaction monitoring mode measuring the carbonyl loss of both compounds. Quantification was performed by peak area comparison using calibration curves. NMR spectroscopy of urine and plasma was performed essentially as described before (Wevers et al., 1994
).
Spectrophotometric determination of respiratory chain enzyme complex activities in muscle homogenate (measured in three patients), determination of the mtDNA/18S rRNA ratio in tissues by Southern blot analysis, SDS electrophoresis/western blotting, total DNA purification and PCR amplification was performed using previously reported methodologies (DiMauro et al., 1987
; Carrozzo et al., 2003
; Janssen et al., 2006
).
The activity of SCA-A was measured as described before (Cha and Parks, 1964
; Elpeleg et al., 2005
) in a mitochondria-enriched 600 g supernatant of a muscle homogenate prepared in 0.25 M sucrose, 2 mM EDTA, 5.104 U/l heparin, 10 mM Tris-Cl pH 7.4. The activity was measured in the direction of succinyl-CoA formation either in the presence of ATP (for SCS-A) or GTP (for SCS-G). The ratio
Abs/min measured with either ATP or GTP present was used to determine the relative activity of the ADP-forming succinyl-CoA.
Immunolabelling of the SUCLA2 gene product used a polyclonal antibody (1 : 1000) kindly provided by Prof. David O. Lambeth. The anti-complex II-70 kDa antibody (0.1 µg/ml), used as internal control, was purchased from Mitosciences (Eugene-OR, USA). Reactive bands were detected using the Immobilon Western Chemiluminescent HRP Substrate detection kit (Millipore Corporation, Billerica, MA, USA). Fluorescence was quantified using the Quantity One Software (BioRad, Hercules, CA, USA).
The coding exons of the SUCLA2 gene and the flanking intronic sequences (Genebank accession no. NM_003850
[GenBank]
) were amplified using intronic primers (sequences and PCR conditions are available by e-mail: carrozzo{at}opbg.net) and the BigDye 3.1 chemistry (Applied Biosystems, Foster City, CA, USA). Numbering of bases is according to the approved nomenclature, with the A of the first methionine as base + 1 (Antonarakis, 1998
). Mutations were confirmed by resequencing a newly amplified PCR product. Segregation of the mutation within the families as well as the analysis of at least 200 control alleles was performed with ad hoc designed PCRrestriction fragment length polymorphism (PCR/RFLP) strategies. Oligonucleotide primers forward (5'
3') AAGATCAAATTTGACTCTAAATCAGCCAAT (mismatched bases are underlined) and backward (5'
3') ATTAAACTTAGTGAATCCAAT were used to demonstrate the presence of p.Arg284Cys mutation in patients 1 and 3, its segregation within the family of patient 1 as well as its absence in controls. The 189-bp PCR amplified fragment is normally cleaved by the Tsp509 I endonuclease into fragments sized 166, 17 and 6 bp whereas the presence of the p.Arg284Cys introduces an additional cleavage site producing fragments sized 145, 21, 17, and 6 bp. The segregation of the p.Gly118Arg mutation in patient 2, its segregation within his family as well as the absence in controls used oligonucleotide primers forward (5'
3') GCTGCTCCATGCTTCATATTT and backward (5'
3') TCCCGTATGTATCATGTCTAC. The heterozygous p.Gly118Arg introduces a single cleavage site for the endonuclease Ear I and produces fragment sized 398 and 117 bp. The segregation of the c.534 + 1G
A mutation within the Faroese families was assessed using oligonucleotide primers forward (5'
3') AACAATGGAAAGGTCATTTTAA (mismatched base is underlined) and backward (5'
3') ATGCTCATGACATACAAACAG. The 154-bp PCR amplified fragment is normally cleaved by the endonuclease Dra I into fragments sized 115 and 39 bp. The splice site mutation introduces an additional Dra I cleavage site resulting in fragments of 95, 39 and 20 bp.
To assess the functional effect of the c.534 + 1G
A mutation, polyA+ RNA was purified from cultured skin fibroblasts and reverse-transcribed to cDNA using the First Strand cDNA Synthesis kit (Roche Diagnostics SpA, Milano, Italy). Oligonucleotide primers 5'-CCGAGGGGACGGGGTCCGA-3' and 5'-ATTTAACACCTTCAGCCATCCA-3' were used to amplify the entire SUCLA2 cDNA. To sequence the two major cDNA fragments of 1.1 and 1 kb, detected in patient 12, the reverse primer 5'-GAGCTTGTTCCTTTTTGATGCC-3' was also used.
DNA from five Faroese patients was included in a whole-genome scan. Two of the patients included were sibs. The Affymetrix GeneChip Mapping 10K Set (Affymetrix UK Ltd., High Wycombe, UK) containing 10 204 single neutral polymorphisms (SNPs) with a mean intermarker distance of 258 kb and an average SNP heterozygosity of 0.38 was used for homozygosity mapping. Regions in which all 5 individuals were homozygous for the same allele and which were either 2 cM or larger in size and/or included
10 homozygous SNPs were selected for further study.
To investigate the allele frequency of the mutated gene in the Faroe Islands, DNA was extracted from neonatal blood spots (Guthrie cards) as described (Santer et al., 2001
). Restriction enzyme analysis using MaeIII was used (primer sequences and PCR conditions are available from Dr Santer upon request).
| Results |
|---|
|
|
|---|
Clinical findings, brain imaging and spectroscopy
Table 1 summarizes the relevant clinical and neuroradiological data obtained in the patients.
|
Onset and progress of the disease were similar in all patients. Clinically the disease in the patients can be characterized as an early neonatal onset encephalomyopathy with dystonia and deafness. Figure 3 illustrates the MRI of the brain of patients 1 (AE) and 2 (GI), at the age of 13 months and 12 months, respectively, showing symmetric T2-hyperintense lesions of putamen and caudate nuclei. In patient 1, the first MRI at 8 months of age showed enlarged subarachnoidal spaces (data not shown) while the second examination at 13 months clearly illustrated deterioration with brain atrophy and involvement of putamen and caudate nuclei (Fig. 3AE). Proton MRS of the brain in patient 1 showed the presence of lactic acid in the basal ganglia (Fig. 3F). Brain MRI of patient 3 at the age of 3 years showed symmetric T2-hyperintense lesions of putamen and caudate nuclei. Early MRIs of 3 Faroese patients at the age of 4, 6 and 14 months (case 9, 11 and 12, respectively) also showed slightly enlarged subarachnoidal spaces and ventricular system. The supratentorial white matter and brainstem were normal. At 14 months (case 12) there were clear symmetric T2-hyperintensive lesions in the putamen, globus pallidus and the caudate nucleus, with the putamen being the most affected. The same abnormalities were also observed, but less pronounced at 6 months of age (case 11) but were absent in case 9 at 4 months of age. Basal ganglia involvement was also observed in CT scans of patients 5 and 6. The MRI findings were confirmed at obduction of patient 8 who died at the age of 15.5 years. Post-mortem findings in this child were generalized brain atrophy with severe dilatation of the ventricles and decreased amounts of white matter. There was extreme atrophy of the basal ganglia with a nucleus caudatus of 12 mm only. There were multiple cysts in the nucleus lentiformis along the capsula externa. In the mesencephalon small pedunculi were observed. There were no further abnormalities in the brainstem with a normal nucleus olivares. Also the nucleus dentatus was unremarkable.
|
Biochemical investigations at the metabolite level
Metabolite findings were remarkably similar in the patients (Table 2). An obvious increase of methylmalonic acid was documented in plasma and to a lesser extent in the urine of the patients (Table 2). This finding was also confirmed with proton NMR spectroscopy. Plasma homocysteine was always normal (data not shown). Lactic acidosis was present in almost all patients although variable over the day and according to the clinical conditions. Lactate values as high as 11.4 mmol/l have been documented. High plasma alanine was a frequent finding. Lactate elevations (>3000 µmol/l) were also documented in CSF of several patients. GCMS analysis of urinary organic acids showed increased levels of some citric acid intermediates in the patients. Methylcitrate and 3-hydroxypropionate were also detectable in some cases. These findings prompted NMR spectroscopy evaluations of urine samples from five patients (Table 2). Surprisingly succinic acid, the product of the defective enzyme, was slightly increased in urine of the patients (range: 120210; reference 581 µmol/mmol creatinine), but not in plasma. A bacterial origin of the succinate is highly unlikely as this was a constant observation in all investigated patients. Also urinary citric acid was obviously increased (range: 6901500 with only 1 sample <1250; reference 120582 µmol/mmol creatinine). In some patients
-ketoglutaric acid and fumaric acid were found intermittently increased.
|
Carnitine ester profiling in plasma showed increased C3-carnitine and C4-dicarboxylic carnitine (Table 2). The excretion of the C4-dicarboxylic carnitine in urine was even more pronounced (around 20 times increased). The C4-dicarboxylic carnitine ester in these patients is likely to be a mixture of the succinyl- and the methylmalonyl carnitine ester.
Biochemical investigations at the protein level
Muscle respiratory chain enzyme activities in patient 1 showed a combined deficiency of the complexes I (50%), III (44%) and IV (36%). Patient 2 had a reduction of 46% of complex IV and lownormal activity of complex I. In the Faroese patient 13, a combined deficiency of complex I and IV (69 and 43%, respectively) was found in a fresh muscle biopsy sample. All values are normalized for citrate synthase activity and expressed as percentage of the lowest control values. In summary a picture emerges for these three patients of a combined deficiency of variable severity for the complexes I and IV of the respiratory chain.
The SCS-A activity in muscle mitochondria from patient 12 was reduced compared with controls (0.59 U/U SCS-G; control range: 0.861.33; n = 5) which is 55% of the mean control activity.
Western blotting of the SUCLA2 gene product in muscle homogenate of patients 1, 2 and 12 showed a reduction to 41, 34 and 81%, respectively, compared with control when normalized on immunodetection of SDH-70 (Fig. 4).
|
Molecular genetic investigations
Mutation analysis of the SUCLA2 gene on genomic DNA showed a homozygous c.850C
T mutation (p.Arg284Cys) in exon 7 in patient 1 and 3. Parents and a healthy sib of patient 1 were heterozygous for this mutation. An older brother did not have a mutated allele. Patient 2 was a compound heterozygote. In one allele he carries the c.850C
T mutation, that was present in the father. In the second allele a mutation c.352G
A (p.Gly118Arg) in exon 3 was detected; this mutation was present in the mother. The association between SUCLA2 and the clinical phenotype was further reinforced through simultaneous genotype analyses in the Faroese families. According to the selection criteria, six regions of 2 cM or larger and three additional regions with 10 or more homozygous SNPs were identified by whole genome scan in the Faroese patient group. In the region on chromosome 13 containing the SUCLA2 gene, 10 SNPs were homozygous covering 1.333 Mb (between SNPs rs724705 and rs1375662; 0.1 cM on the Marshfield map). In the affected cases from the Faroese families a homozygous splice site c.534 + 1G
A mutation was found in the SUCLA2 gene. DNA samples of all the parents (14 people) analysed by RFLP show heterozygosity for this mutation. Of the remaining 28 relatives analysed, 14 were heterozygous and 14 were homozygous for the wild-type. The gene has a relative common variation at position IVS3 + 9 (c > t). The c.534 + 1G
A mutation was always found to be associated with the polymorphism t. PCR analysis of cDNA did not show substantial levels of wild-type SUCLA2 cDNA under our experimental conditions, although we cannot completely exclude the presence of a faint band at this position (Fig. 5). Two major fragments of a smaller size were amplified (Fig. 5, top). Sequence analysis of the 1.1 kb fragment showed skipping of exons 2, 3 and part of exon 4 (Fig. 5, bottom, B). The sequence of the lower band showed skipping of exons 24 (Fig. 5, bottom, C). Therefore, cDNA analysis was consistent with skipping of multiple exons, at least in cultured cells.
|
These three novel mutations of SUCLA2 gene were not detected in over 200 control alleles.
In the remaining cases previously reported (Stromme et al., 1995
; Yano et al., 2003
; Deodato et al., 2005
), we did not detect SUCLA2 mutations in the genomic DNA.
Frequency of the mutated allele on the Faroe Islands
Among 272 randomly selected anonymous neonatal DNA samples from the Faroe Islands we found nine heterozygotes and one homozygous case. Applying DNA fingerprint analysis using eight highly polymorphic short tandem repeat systems we could demonstrate that the homozygous sample shows a completely identical pattern to patient 12. This strongly suggests that it came from this individual. Thus, based on 11 mutated alleles among 544 investigated, allele frequency for the SUCLA2 c.534 + 1G
A mutation in this population was calculated to be 2.0% [95% confidence interval(CI) 0.93.3%]. This predicts a carrier frequency of 1 : 25 (95% CI 1 : 1555) and the theoretical frequency for homozygosity therefore amounts to 1 : 2500 (95% CI 1 : 91011800).
Mitochondrial DNA depletion
The relative mtDNA/18S rRNA ratio was investigated in muscle and cultured fibroblasts (Fig. 6). The mtDNA content in muscle of patients 1 and 2 was reduced to 21 and 32% of the mean control value, respectively. The same patients had a reduction of 56 and 50% also in fibroblasts. Patient 12 showed normal mtDNA content in fibroblasts (muscle sample was not available for Southern blot analysis).
|
| Discussion |
|---|
|
|
|---|
Mild MMA, Leigh-like encephalomyopathy, dystonia and deafness characterizes a group of patients with SUCLA2 gene mutations, in whom the key diagnostic features are represented by mild methylmalonic acid excretion combined with an abnormal profile of carnitine esters. Together with
-ketoglutarate dehydrogenase complex, succinate dehydrogenase and fumarate hydratase deficiencies, this condition also may be ranked among the inherited disorders of the TCA cycle (Pithukpakorn, 2005
The mild MMA, the abnormal excretion of some TCA cycle intermediates and the abnormal results of respiratory chain measurements pointed to SUCLA2 as a possible candidate gene in our patients. Moreover their clinical features together with mtDNA depletion were all in line with the first description of a SUCLA2 deficiency by Elpeleg et al. (2005
). The genome scan data on the Faroese families also confirmed our hypothesis. Accordingly, the three mutations that we subsequently detected in this gene have obvious features of pathogenicity. The p.Arg284Cys (found in three patients) and p.Gly118Arg mutations affect residues that are highly conserved during evolution (Johnson et al., 1998
). The c.534 + 1G
A affects the consensus splice site of intron 4 leading to multiple exon skipping. Interestingly, the p.Arg284Cys mutation was found heterozygous in both parents of patient 1 (DNA samples from relatives of patient 3 were not available), and in the father of patient 2, originating from two small villages in close proximity in southern Italy.
On the protein level we showed that the content of the SUCLA2 gene product is diminished and that the enzymatic activity of SCS-A in muscle mitochondria in one case is reduced compared with those in mitochondria from control muscle samples. The residual activity might be due to the presence of additional, longer transcripts (see asterisks in Fig. 5, top panel). These functional data, together with absence of these mutations in a large set of control alleles and segregation of the mutation with the disease phenotype within families are strongly indicative for the pathogenic character of the novel variants identified in this study. The clinical spectrum of the SUCLA2 defect that emerges is rather homogeneous.
The SUCLA2 gene encodes the ß-subunit of the heterodimeric mitochondrial matrix enzyme SCS-A. GDP-forming succinyl-CoA synthase (SCS-G; EC 6.2.1.4
[EC]
) contains another ß-subunit than SCS-A. SCS-A and SCS-G both may catalyse the reverse reaction from succinyl-CoA to succinate in the TCA cycle. Lambeth et al. (2004
) have shown that mRNA expression as well as the amount of protein and enzymatic activity of SCS-A and SCS-G vary considerably between tissues in one species but also between species. Western blot studies showed that the SCS-A ß-subunit is highly expressed in testis, brain, heart and kidney while the SCS-G ß-subunit occurs in high amounts in liver, kidney and heart but barely in brain and testis. The resulting deficiency of SCS-A activity in brain would, therefore, be the basis for the encephalopathy in the patients as the deficiency cannot be compensated in the brain by SCS-G activity. It has been observed that the ß-subunit of SCS-G is much more highly expressed in anabolic tissues as kidney and liver and its role may be to support GDP-dependent anabolic processes (Lambeth et al., 2004
). At present it is unclear how the two enzymes function in concert within the same mitochondria and whether or not one enzyme may be able to compensate for the absence of the other.
The mild methylmalonic acidaemia with normal homocysteine, and the increased C4-dicarboxylic-carnitine level in plasma and even more in urine are the hallmarks of the disease at the metabolite level. As expected in a TCA cycle defect, variable lactic acidaemia and consistent lactate increase in CSF are accompanying characteristics in patients with a SUCLA2 defect. TCA cycle intermediates were found increased to a variable extent in the urine of the patients. The increase of methylmalonic acid in body fluids that is considerably less pronounced in patients with the SUCLA2 defect than in classical MMA (Deodato et al., 2006
), may be explained by the impaired conversion of succinyl-CoA to succinate, resulting in metabolite accumulation proximal to the enzymatic block (Fig. 1).
It may well be that the increased C4-dicarboxylic carnitine ester in our patients is a mixture of methylmalonylcarnitine and succinylcarnitine (Fig. 1). Succinylcarnitine is likely to be formed from accumulating succinyl-CoA. The concentration of C4-dicarboxylic carnitine is more increased in urine than in plasma. This may relate to the variable presence of SCS-A in different tissues and cell types.
The majority of the present population of the Faroe Islands descends from a small number of settlers. Thus, the genetic pool is small containing a number of mutations that occurred long ago. The observation that the pathogenic c.534 + 1G
A SUCLA2 mutation was always found associated with the t-variant in the polymorphism at position IVS3 + 9 is in line with a founder effect. Given the allele frequency of the SUCLA2 mutation on the island, it is estimated that 1 in 2500 neonates will be affected with the disease. A similar situation exists on the Faroe Islands for other genetic diseases including cystic fibrosis, glycogen storage disease type III and N-acetylglutamate synthase deficiency. It may be an option for the island to start a prevention project for such severe disorders comparable with the successful prevention projects for thalassaemia on Cyprus (Angastiniotis et al., 1992
; Angastiniotis, 1995
) or the Dor Yeshorim prevention programme for Tay Sachs disease in a Jewish community in the US (Ekstein and Katzenstein, 2001
). These programmes rely on premarital anonymous identification of heterozygotes to prevent affected births by identifying couples at risk. The allele frequency of the SUCLA2 defect on the island makes this disease a potential candidate for such an approach if it turns out that no rational therapy for this devastating disease can be found.
Our results indicate that the few reported unlabelled cases of mild MMA may have variance in the phenotypic expression (Stromme et al., 1995
; Yano et al., 2003
; Deodato et al., 2005
) and are genetically heterogeneous. A few noteworthy differences were almost invariably observed between cases having changes in SUCLA2 and those who tested negative for gene mutations. These include the presence of sensorineural hearing deficit and the selective bilateral involvement of the putamen and caudate nucleus in patients with the SUCLA2 defect. The lack of common distinctive clinical, biochemical or molecular features in the SUCLA2-negative patients suggests that further heterogeneity is to be expected.
The single report on SUCLA2 mutations associates variations in this gene with a Leigh-like encephalomyopathy and mtDNA depletion (Elpeleg et al., 2005
). Our data confirm the mitochondrial DNA depletion in muscle tissue, as well as in some of the cultured fibroblasts. This confirms the previous finding that SCS-A activity may play a crucial role in controlling mtDNA maintenance (Elpeleg et al., 2005
). Moreover, the normal content of mtDNA that we observed in two out of four fibroblast samples may be due to the tissue specificity/heterogeneity of the genetic defect (Carrozzo et al., 2003
). The precise primary or secondary mechanism(s) responsible for mtDNA depletion, however, still remains unknown. Elpeleg et al. (2005
) postulated that a disturbance in the tight complex of succinyl-CoA synthase with mitochondrial nucleoside diphosphate kinase may influence the phosphorylation of mitochondrial deoxyribonucleotide diphosphates resulting in diminished mitochondrial DNA synthesis. The SUCLA2 defect adds a further presentation to the already heterogeneous group of mitochondrial depletion syndromes.
In conclusion, we confirm and extend the findings on this inborn error of metabolism in the TCA cycle that must be carefully searched for by accurate metabolite analyses.
| Footnotes |
|---|
Rosalba Carrozzo and Carlo Dionisi-Vici equally contributed to the design and preparation of the manuscript. | Acknowledgements |
|---|
The authors thank the relatives of the Faroese patients for their willingness to give blood for the genome scan and the Faroese health authorities for allowing us to investigate a large cohort from these families at the molecular genetic level. Furthermore we thank R. Baumgartner and S. Yano who referred their patients to us, David O. Lambeth for the kind gift of the SUCLA2 antibody and C. Augustin for the DNA fingerprint analysis. Also we thank Dr S. J. R. Heales (Institute of Neurology, London, UK) for providing the data on the respiratory chain complexes of patient 13 in this article. The financial support of the Italian Ministry of Health (Ricerca Corrente e Finalizzata) and the Clinical Genetics Centre Nijmegen, The Netherlands is gratefully acknowledged.
| References |
|---|
|
|
|---|
Angastiniotis M. (1992) Management of thalassemia in Cyprus. Birth Defects Orig Artic Ser 28:3843.[Medline]
Angastiniotis M, Modell B, Englezos P, Boulyjenkov V. (1995) Prevention and control of haemoglobinopathies. Bull World Health Organ 73:37586.[Web of Science][Medline]
Antonarakis SE. (1998) Recommendations for a nomenclature system for human gene mutations. Nomenclature Working Group. Hum Mutat 11:13.[CrossRef][Web of Science][Medline]
Bikker H, Bakker HD, Abeling NG, Poll-The BT, Kleijer WJ, Rosenblatt DS, et al. (2006) A homozygous nonsense mutation in the methylmalonyl-CoA epimerase gene (MCEE) results in mild methylmalonic aciduria. Hum Mutat 27:6403.[CrossRef][Web of Science][Medline]
Carrozzo R, Bornstein B, Lucioli S, Campos Y, de la Pena P, Petit N, et al. (2003) Mutation analysis in 16 patients with mtDNA depletion. Hum Mutat 21:4534.[Medline]
Cha S and Parks RE. (1964) Succinic thiokinase. I. Purification of the enzyme from pig heart. J Biol Chem 239:19617.
Deodato F, Boenzi S, Santorelli FM, Dionisi-Vici C. (2006) Methylmalonic and propionic aciduria. [Review]. Am J Med Genet C Semin Med Genet 142:10412.[Medline]
Deodato F, Brancati F, Valente EM, Carrozzo R, Di Rosa G, Boenzi S, et al. (2005) MAMEL (methylmalonic aciduria mitochondrial encephalopathy Leigh-like) a new mitochondrial encephalopathy. J Inher Metab Dis 28:Suppl 1, 130.
DiMauro S, Servidei S, Zeviani M, DiRocco M, De Vivo DC, DiDonato S, et al. (1987) Cytochrome c oxidase deficiency in Leigh syndrome. Ann Neurol 22:498506.[CrossRef][Web of Science][Medline]
Dobson CM, Gradinger A, Longo N, Wu X, Leclerc D, Lerner-Ellis J, et al. (2006) Homozygous nonsense mutation in the MCEE gene and siRNA suppression of methylmalonyl-CoA epimerase expression: a novel cause of mild methylmalonic aciduria. Mol Genet Metab 88:32733.[CrossRef][Web of Science][Medline]
Ekstein J and Katzenstein H. (2001) The Dor Yeshorim story: community-based carrier screening for Tay-Sachs disease. Adv Genet 44:297310.[Web of Science][Medline]
Elpeleg O, Miller C, Hershkovitz E, Bitner-Glindzicz M, Bondi-Rubinstein G, Rahman S, et al. (2005) Deficiency of the ADP-forming succinyl-CoA synthase activity is associated with encephalomyopathy and mitochondrial DNA depletion. Am J Hum Genet 76:10816.[CrossRef][Web of Science][Medline]
Farina L, Chiapparini L, Uziel G, Bugiani M, Zeviani M, Savoiardo M. (2002) MR findings in Leigh syndrome with COX deficiency and SURF-1 mutations. Am J Neuroradiol 23:1095110.
Janssen AJ, Trijbels FJ, Sengers RC, Wintjes LTM, Ruitenbeek W, Smeitink JAM, et al. (2006) Measurement of the energy-generating capacity of human muscle mitochondria: diagnostic procedure and application to human pathology. Clin Chem 52:86071.
Johnson JD, Mehus JG, Tews K, Milavetz BI, Lambeth DO. (1998) Genetic evidence for the expression of ATP- and GTP-specific succinyl-CoA synthetases in multicellular eucaryotes. J Biol Chem 273:275739.
Lambeth DO, Tews KN, Adkins S, Frohlich D, Milavetz BI. (2004) Expression of two succinyl-CoA synthetases with different nucleotide specificities in mammalian tissues. J Biol Chem 279:366214.
Longo D, Fariello G, Dionisi-Vici C, Cannata V, Boenzi S, Genovese E, et al. (2005) MRI and 1H-MRS findings in early-onset cobalamin C/D defect. Neuropediatrics 36:36672.[CrossRef][Web of Science][Medline]
Mayatepek E, Hoffmann GF, Baumgartner R, Schulze A, Jakobs C, Trefz FK, et al. (1996) Atypical vitamin B12-unresponsive methylmalonic aciduria in a sibship with severe progressive encephalomyelopathy: a new genetic disease? Eur J Pediatr 155:398403.[Web of Science][Medline]
Mueller P, Schulze A, Schindler I, Ethofer T, Buehrdel P, Ceglarek U. (2003) Validation of an ESI-MS/MS screening method for acylcarnitine profiling in urine specimens of neonates, children, adolescents and adults. Clin Chim Acta 327:4757.[CrossRef][Web of Science][Medline]
Pithukpakorn M. (2005) Disorders of pyruvate metabolism and the tricarboxylic acid cycle. [Review]. Mol Genet Metab 85:2436.[CrossRef][Web of Science][Medline]
Rizzo C, Boenzi S, Wanders RJ, Duran M, Caruso U, Dionisi-Vici C. (2003) Characteristic acylcarnitine profiles in inherited defects of peroxisome biogenesis: a novel tool for screening diagnosis using tandem mass spectrometry. Pediatr Res 53:10138.[CrossRef][Web of Science][Medline]
Santer R, Kinner M, Steuerwald U, Kjaergaard S, Skovby F, Simonsen H, et al. (2001) Molecular genetic basis and prevalence of glycogen storage disease type IIIA in the Faroe Islands. Eur J Hum Genet 9:38891.[CrossRef][Web of Science][Medline]
Stromme P, Stokke O, Jellum E, Skjeldal OH, Baumgartner R. (1995) Atypical methylmalonic aciduria with progressive encephalopathy, microcephaly and cataract in two siblingsa new recessive syndrome? Clin Genet 48:15.[Web of Science][Medline]
Tarsy D and Simon DK. (2006) Dystonia. [Review]. N Engl J Med 355:81829.
Trinh BC, Melhem ER, Barker PB. (2001) Multi-slice proton MR spectroscopy and diffusion weighted imaging in methylmalonic acidemia: report of two cases and review of the literature. Am J Neuroradiol 22:8313.
Vreken P, van Lint AE, Bootsma AH, Overmars H, Wanders RJ, van Gennip AH. (1999) Rapid diagnosis of organic acidemias and fatty-acid oxidation defects by quantitative electrospray Tandem-MS acylcarnitine analysis in plasma. Adv Exp Med Biol 466:32737.[Web of Science][Medline]
Wevers RA, Engelke U, Heerschap A. (1994) High-resolution 1H-NMR spectroscopy of blood plasma for metabolic studies. Clin Chem 40:124550.
Yano S, Li L, Le TP, Moseley K, Guedalia A, Lee J, et al. (2003) Infantile mitochondrial DNA depletion syndrome associated with methylmalonic aciduria and 3-methylcrotonyl-CoA and propionyl-CoA carboxylase deficiencies in two unrelated patients: a new phenotype of mtDNA depletion syndrome. J Inherit Metab Dis 26:4818.[CrossRef][Web of Science][Medline]
Zeviani M and Di Donato S. (2004) Mitochondrial disorders. [Review]. Brain 127:215372.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Bulst, A. Abicht, E. Holinski-Feder, S. Muller-Ziermann, U. Koehler, C. Thirion, M. C. Walter, J. D. Stewart, P. F. Chinnery, H. Lochmuller, et al. In vitro supplementation with dAMP/dGMP leads to partial restoration of mtDNA levels in mitochondrial depletion syndromes Hum. Mol. Genet., May 1, 2009; 18(9): 1590 - 1599. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Wortmann, R. J. T. Rodenburg, A. Jonckheere, M. C. de Vries, M. Huizing, K. Heldt, L. P. van den Heuvel, U. Wendel, L. A. Kluijtmans, U. F. Engelke, et al. Biochemical and genetic analysis of 3-methylglutaconic aciduria type IV: a diagnostic strategy Brain, January 1, 2009; 132(1): 136 - 146. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rahman and J. Poulton Diagnosis of mitochondrial DNA depletion syndromes Arch. Dis. Child., January 1, 2009; 94(1): 3 - 5. [Full Text] [PDF] |
||||
![]() |
Mitochondrial Encephalomyopathy: Know Your TCA Cycle? Journal Watch Neurology, June 12, 2007; 2007(612): 3 - 3. [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









