Brain Advance Access published online on December 13, 2007
Brain, doi:10.1093/brain/awm293
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mutations in SPG11 are frequent in autosomal recessive spastic paraplegia with thin corpus callosum, cognitive decline and lower motor neuron degeneration

1INSERM, U679, 2Université Pierre et Marie Curie - Paris 6, UMR S679, 3APHP, Département de Génétique et Cytogénétique, Groupe Hospitalier Pitié-Salpêtrière, Paris, 4Centre de Référence de Neurogénétique, CHU dAngers, France, 5Unit of Molecular Medicine, IRCCS-Bambino Gesù Children's Hospital, Rome, Italy; 6Service de Neurologie, Hôpital Habib Bourguiba, Sfax, Tunisia, 7Service de Neurologie, Hôpital Mustapha, Algiers, Algeria, 8Department of Neurology, Hadassah-Hebrew University Medical Center, Jerusalem, Israel, 9Laboratorio de Biologia Cellular y Molecular, Fundacion Allende and Sanatorio Allende, Cordoba, Argentina, 10Department of Human Genetics, Hadassah-Hebrew University Medical Center, Jerusalem, Israel, 11Hôpital Benbadis, Constantine, Algeria 12Serviço Neurologia, Hospital De Egas Moniz, Lisboa, 13Departamento de Neurologia, Hospital S. Sebastiao, Santa Maria da Feira, Portugal, 14Department of Neurology, Brain Research Institute, Niigata University, Niigata, Japan, 15Department of Neurology, Rouen University Hospital and 16INSERM, U614, Rouen, France, 17Neurology Department, Hôpital Civil, Strasbourg, France, 18Service de Génétique, Hôpital Pellegrin, Bordeaux, France, 19Service de Neurologie, CHU de Montpellier, Hôpital Gui de Chauliac, Montpellier, France, 20Neurological Clinic of Yokohama, Yamate, Japan, 21Department of Neurology, University of Regensburg, Germany, 22Ulleval University Hospital, Oslo, Norway and 23Centre Hospitalier Régional Universitaire, EA2691, Lille, France
Correspondence to:
Prof Alexis Brice, INSERM U679, IFR de Neurosciences, Pitié-Salpêtrière Group, 47 Bd de l'Hôpital, 75013 Paris, France E-mail: brice{at}ccr.jussieu.fr
| Summary |
|---|
|
|
|---|
Hereditary spastic paraplegias (HSP) are neurodegenerative diseases mainly characterized by lower limb spasticity associated, in complicated forms, with additional neurological signs. We have analysed a large series of index patients (n = 76) with this condition, either from families with an autosomal recessive inheritance (n = 43) or isolated patients (n = 33), for mutations in the recently identified SPG11 gene. We found 22 truncating mutations, including the first four splice-site mutations, segregating in seven isolated cases and 13 families. Nineteen mutations were novel. Two recurrent mutations were found in Portuguese and North-African patients indicating founder effects in these populations. The mutation frequency varied according to the phenotype, from 41%, in HSP patients presenting with a thin corpus callosum (TCC) visualized by MRI, to 4.5%, in patients with mental impairment without a TCC. Disease onset occurred during the first to the third decade mainly by problems with gait and/or mental retardation. After a mean disease duration of 14.9 ± 6.6 years, the phenotype of 38 SPG11 patients was severe with 53% of patients wheelchair bound or bedridden. In addition to mental retardation, 80% of the patients showed cognitive decline with executive dysfunction. Interestingly, the phenotype also frequently included lower motor neuron degeneration (81%) with wasting (53%). Slight ocular cerebellar signs were also noted in patients with long disease durations. In addition to a TCC (95%), brain MRI revealed white matter alterations (69%) and cortical atrophy (81%), which worsened with disease duration. In conclusion, our study reveals the high frequency of SPG11 mutations in patients with HSP, a TCC and cognitive impairment, including in isolated patients, and extends the associated phenotype.
Key Words: spastic paraplegias; SPG11; thin corpus callosum; mental retardation; lower motor neuron degeneration
Abbreviations: AR, autosomal recessive; HSP, hereditary spastic paraplegias; IQ, intellectual quotient; LL, lower limbs; MMSE, Mini Mental State Evaluation; UL, upper limbs; SPG, spastic paraplegia gene; TCC, thin corpus callosum; WMA, white matter abnormalities
.
Received September 28, 2007. Revised November 3, 2007. Accepted November 8, 2007.
| Introduction |
|---|
|
|
|---|
Hereditary spastic paraplegias (HSP) are neurodegenerative conditions in which the main clinical features are progressive spasticity and weakness of the lower limbs associated with posterior column or bladder involvement (Harding, 1983
In AR-HSP, observed more frequently than autosomal dominant HSP in inbred populations (Coutinho et al., 1999
), the first three genes identified that encode paraplegin (SPG7), spartin (SPG20) and maspardin (SPG21) (Casari et al., 1998
; Patel et al., 2002
; Simpson et al., 2003
), as well as the gene responsible for the related spastic ataxia of Charlevoix Saguenay (Engert et al., 2000
), represent only a small proportion of all cases (Fink, 2003
). Strikingly, about one-third of AR-HSP index patients have a thin or atrophied corpus callosum (ARHSP-TCC) visualized by MRI with different degrees of cognitive deficit (Franca et al., 2007
). This form of AR-HSP was initially mapped to chromosome 15q13-15 [SPG11, (Martinez et al., 1999
)] and accounts for 41–77% of reported ARHSP-TCC families (Shibasaki et al., 2000
; Casali et al., 2004
; Stevanin et al., 2006
). Recently, the SPG11 gene, also known as KIAA1840/FLJ21439, that encodes spatacsin, was identified and was mutated in 11 of 12 ARHSP-TCC index patients (Stevanin et al., 2007
). Ten different mutations were identified in the 11 families. They were either nonsense mutations, deletions or insertions in the SPG11 coding sequence, resulting theoretically in an abnormally truncated protein in all cases.
The aims of the present study were to estimate the frequency of SPG11 mutations in a large series of patients with ARHSP with or without TCC, mental retardation or cognitive impairment, to define the spectrum of the mutations in this gene and to describe the associated phenotypes.
| Materials and Methods |
|---|
|
|
|---|
Subjects
Forty-three kindreds with an autosomal recessive inheritance and 33 isolated cases with no family history of the disease were selected, 22 and 5 of which were consanguineous, respectively. Index patients presented with either (i) spastic paraplegia with a mental retardation or cognitive impairment and TCC visualized at MRI (n = 26), (ii) spastic paraplegia with TCC without mental retardation and cognitive impairment (n = 11) or (iii) spastic paraplegia with mental retardation or cognitive impairment without TCC (n = 22). In addition, 17 index patients presenting with spastic paraplegia and mental retardation or cognitive impairment for which MRI was not available were also analysed. This study has been approved by the local Bioethics committee (approval no 03-12-07 of the Comité Consultatif pour la Protection des Personnes et la Recherche Biomédicale Paris-Necker to Drs A. Durr and A. Brice). Informed written consent has been given by all participating members of the families before blood samples were collected for DNA extraction. All clinical evaluations were performed according to a protocol established by the European and Mediterranean network for spinocerebellar degenerations (SPATAX, coordinator: Dr A. Durr) that included: full medical history and examination, estimation of the age at onset by the patient, presence or absence of additional neurological symptoms/signs, electroneuromyographic (ENMG) studies and brain MRI when possible. IQ or Mini Mental State Evaluations (MMSE) (Folstein et al., 1975
Most patients were French (n = 37) or North-African (n = 15), or originated from other European countries (n = 13), the Middle-East (n = 6) and elsewhere (n = 5). Eleven of the 33 sporadic subjects previously tested negative for mutations or rearrangements in the SPG4 gene (Depienne et al., 2006
, 2007
); mutations in the SPG7 gene were also excluded in a subset (n = 20/43) of families (Elleuch et al., 2006
).
Genotyping
Linkage to SPG11 was investigated in 33 AR-HSP families using the polymorphic markers D15S781, D15S537, D15S516 and D15S659 after DNA amplification by polymerase chain reaction (PCR); the amplicons were sized on an ABI Prism 3730 automated sequencer with GenMapper software (Applied Biosystems, Foster City, CA, USA), as previously described (Stevanin et al., 2006
). After haplotype reconstruction, putative linkage was established on the basis of common haplotypes by descent in affected relatives of the same pedigree.
Mutation detection
The coding sequence and splice site boundaries of the 40 exons of the SPG11 gene were amplified by PCR and sequenced in both directions as described previously (Stevanin et al., 2007
).
Numbering of new mutations/polymorphisms was performed relative to the ATG codon of the first coding exon, as recommended by the Human Genome Variation Society (http://www.hgvs.org/mutnomen/). Segregation of the mutations/polymorphisms with the disease was verified by direct sequencing in 64 additional family members whose DNA samples were available. In addition, unrelated healthy subjects were screened to evaluate the frequency of nucleotidic changes: 80 French Caucasians, 31 North-Africans, 103 Palestinians and 48 individuals from Argentina. Synonymous, missense and splice-site variations were systematically evaluated for modifications of exonic splicing enhancers (ESEfinder algorithm available at http://www.rulai.cshl.edu/cgi-bin/tools/ESE/esefinder.cgi) or consensus splicing sequences (at http://rulai.cshl.edu/new_alt_exon_db2/HTML/score.html and http://www.fruitfly.org/seq_tools/splice.html). Multiple alignment with spatacsin orthologs in various species was performed using ClustalW software (http://www.ebi.ac.uk/clustalw/) to evaluate conservation of missense variants.
The effect on mRNA splicing of a variant affecting the last codon of exon 15 was analysed by RT-PCR on RNA extracted from the lymphoblasts of patient FSP670-5, as reported elsewhere (Stevanin et al., 2007
) using primers cDNAF—GCTCTGTGGTGGGATCAACT (exon 14) and cDNAR—TGCTTACACTGGCCTGATTG (exon 18) at an annealing temperature of 60°C, followed by direct sequencing of the PCR product.
| Results |
|---|
|
|
|---|
Linkage studies
We initially analysed the segregation of four microsatellite markers tightly flanking the SPG11 gene in 33 kindreds, in which at least two affected patients were sampled. Twelve families were excluded because no common haplotypes segregated with the disease in affected relatives. In 21 families (64%), the reconstruction of the haplotypes was compatible or did not exclude linkage to SPG11. In these 21 families, the SPG11 gene was sequenced.
SPG11 mutation screening
Direct sequencing of the SPG11 gene was performed in 64 unrelated index patients, including the probands of the 21 putatively linked families mentioned earlier and 43 index patients not analysed by linkage studies. We identified 22 truncating mutations in the index patients of 20 families, 19 were newly identified variants (Table 1). In 14 of these families, the mutations were homozygous. In six kindreds, the patients had two compound heterozygous mutations. The mutations segregated with the disease in the families where this could be tested (Supplementary figure). Unaffected relatives (n = 47) never had two mutations in the SPG11 gene.
|
Most mutations were nonsense mutations (n = 4, three new); small deletions (n = 13, 11 new) or insertions (one new). In addition, we identified four new mutations predicted to affect the splicing of the KIAA1840 mRNA and that were not found on at least 160 and 62 Caucasian and North-African control chromosomes, respectively. In the Israeli-Arab family FSP670, the homozygous c.2833A>G mutation in the last conserved codon of exon 15, leading to the missense variation p.R945G, was also shown to affect the 5' splice consensus site (score of +2.7 versus +4.9 for the wild-type sequence). This in silico prediction was confirmed on mRNA isolated from lymphoblasts of an affected family member (FSP670-5) in which an alternative donor splice site is generated downstream in intron 15 leading to a 65 bp insertion and a premature stop codon (Fig. 1; r.2834 + 1_2834 + 65ins, p.R945GfsX5). The c.2833A>G mutation was also absent from 103 healthy unrelated Palestinians. In families FSP847 and FSP892, homozygous G>A transitions at positions c.869 + 1 and c.2316 + 1 in intron 4 and intron 12 were predicted to strongly alter the consensus sequence score from +9.8 to –0.9 and from +6.2 to –4.5, respectively. The c.869 + 1G>A mutation, found in family FSP847, was also absent from 48 healthy unrelated Argentineans. The single patient from family FSP830, who carried a heterozygous nonsense mutation in exon 6 (c.1282A>T, p.K428X), also carried an A>G transition at position c.6477 + 4 in intron 34 for which the splice score (http://rulai.cshl.edu/new_alt_exon_db2/HTML/score.html) was reduced from +9.6 to +6.6. Living cells were not available, however, to confirm the in silico predictions of missplicing in families FSP847, FSP892 and FSP830.
|
The 22 identified mutations were located in—or close to—15 different exons throughout the gene, from exon 1 to exon 37. However, two of these mutations were found in more than one family. Mutation c.6100C>T/p.R2034X was found in four different kindreds from Algeria, Morocco and Tunisia and was previously reported in three North African families (Stevanin et al., 2007
|
Four exonic nucleotide variants present in patients but also in >2% of control chromosomes from France and North Africa are likely to be polymorphisms: c.808G>A/p.V270I (1.5 versus 2.3% in controls), c.1388T>C/p.F463S (47 versus 51%), c.3420G>A/p.L1140L (2.3 versus 3.3%) and c.7023C>T/p.Y2341Y (1.5 versus 7.1%). The p.F463S and p.L1140L variants have already been described in the NCBI (http://www.ncbi.nlm.nih.gov) and Ensembl (http://www.ensembl.org) human genome databases, and the silent changes at residues 1140 and 2341 occurred in the presence of homozygous truncating mutations in the SPG11 gene. None of them were shown to modify splice sites. Three additional intronic polymorphisms were detected at positions –139A>G and –141A>C upstream exon 8, and +62C>T downstream exon 37 but were not predicted to cause missplicing of the SPG11 gene.
Clinical characteristics of the 20 new SPG11 families (38 patients)
Six families were North African (two Algerian, two Tunisian and two Moroccan), eight European (four from Portugal, two from France, one from Romania and one from Norway), four Middle-Eastern (two Israeli, one of which of Arabic origin, one Turkish and one Saudi-Arabian) and one each from Argentina and Japan.
Most of the families (65%) had a clear autosomal recessive mode of inheritance, whereas seven index patients (35%), including five without consanguinity, had no family history of neurological disorders.
Age at onset in 37 SPG11 patients ranged from 2 to 27 with a mean of 14.0 ± 5.9 years. Onset was, in most cases, characterized by gait disorders (30/38, 79%), or less frequently by mental retardation (6/38, 16%), rarely dysarthria and tremor (one each). After a mean disease duration of 14.9 ± 6.6 years (range: 2–35), all patients had a severe clinical picture that included progressive spastic paraplegia (Table 3): most were at least wheelchair bound (20/38, 53%) or needed assistance for walking (6/38, 16%), but 12 could still walk without help (Fig. 2). While only 12% of the patients were confined to a wheelchair or bedridden after <10 years of disease, 60% were in this condition after 18 years of evolution (Fig. 2). Patients were wheelchair bound after a mean disease duration of 16.5 ± 5.8 years (range 9–35, n = 20). Lower limb spasticity was severe in 25/37 (67%), associated with severe weakness in 19/37 (51%). Distal or generalized wasting was also noted in 20/38 (53%). Dysarthria was frequently observed (n = 16/38, 42%). Mental retardation, illustrated by learning difficulties in childhood, was present in 12 patients and confirmed in eight who had a mean IQ of 58 ± 9 (range: 45–69). In addition, in 80% (24/30) of the patients, cognitive decline was evident on examination and worsened with time. MMSE scores were low in 4/5 patients tested (<23/30). Only one patient, who had the shortest disease duration (FSP683-3, 2 years), had no mental retardation and cognitive decline. Two patients underwent detailed neuropsychological evaluation (FSP522-1 and FSP75-21). The non-verbal evaluation of global cognitive efficiency in patient FSP522-1 was normal (PM38 = 46/60), but she had a severe memory impairment (Wechsler Memory Quotient = 72/140) associated with reduced verbal fluency and an attention deficit indicative of executive dysfunction. A second evaluation, 5 years later, showed deterioration of her cognitive status. Patient FSP75-21, who had mental retardation (IQ = 56), showed a MMSE score of 21/30 at 35 years with psychiatric and cognitive difficulties that included auditory hallucinations and executive dysfunctions.
|
|
Cerebellar ocular signs such as abnormal saccadic pursuit and nystagmus were noted in seven patients, most of whom had disease durations >15 years (5/21 versus 2/17). There was pes cavus in eight patients, scoliosis in five and other signs were occasionally observed: parkinsonism, orthostatic hypotension, macular excavation or degeneration, strabismus. Four patients, all with disease durations of >18 years, had swallowing difficulties.
Interestingly, ENMG detected lower motor neuron involvement in 13/16 (81%) after a mean disease duration of 14.4 ± 4.9 years (Table 4). In two patients, there was clear anterior horn involvement, while in the others there was axonal neuropathy. Brain MRI showed a TCC (20/21, 95%), with cortical atrophy (17/21, 81%) and associated with diffuse white matter hyperintensities on T2 images (13/19, 69%). The atrophy of the corpus callosum was found in all but one patient (FSP400-5, 7-year disease duration), but with variable intensity (Fig. 3). Leucoencephalopathy was periventricular and confluent, and its severity increased with disease duration. In mild cases, only frontal and occipital periventricular damage was seen (Fig. 3). Finally, visual evoked potentials were abnormal in three out of five patients, indicating an even more diffuse distribution of the lesions.
|
|
| Discussion |
|---|
|
|
|---|
The identification of 22 different truncating mutations (19 new) distributed throughout the SPG11 gene (Fig. 4) emphasizes the need to analyse the whole gene in clinical practice. Only two of these mutations were found in more than two families in this study and previous studies, suggesting regional founders in these populations (Stevanin et al., 2007
|
Most of the 20 new SPG11 families originated from the Mediterranean basin, but mutations were also found in families from Scandinavia, Japan and South America, indicating a worldwide distribution of this clinico-genetic entity, as previously suggested (Shibasaki et al., 2000
When the eleven previously reported cases (Stevanin et al., 2007
) from our series are taken into account, SPG11 mutations are found in
26% (9/35) of apparently sporadic HSP with TCC patients and
40% (22/53) of subjects with complex AR-HSP. Interestingly, the frequency varies widely according to the phenotype (Table 5). SPG11 mutations were found in 59% of patients with TCC and mental impairment collected by our network, a frequency very close to the 41–77% of families from Italy, Japan and Mediterranean countries found in previous linkage analyses (Shibasaki et al., 2000
; Casali et al., 2004
; Stevanin et al., 2006
). Mutations in SPG11 accounted for only a single family (1/22, 4.5%) of the subgroup of patients with HSP and cognitive impairment without TCC, but patients from this kindred had mild white matter changes and cortical atrophy after a short disease duration of 7 years. SPG11 is therefore the major identified cause of HSP-TCC and, when taking into account the proportion of 1/3 of HSP-TCC among ARHSP (Franca et al., 2007
), SPG11 is responsible for
21% of families with ARHSP, making it the most frequent cause of this disease.
|
The clinical features of the SPG11 patients studied here were similar to previous reports (Shibasaki et al., 2000
The phenotype of 21 patients from 15 kindreds with TCC and mental impairment but no mutations in SPG11 did not differ from SPG11 patients except for an earlier mean age at onset of 9.6 ± 13.0 (range: 6 months to 50 years). Gait instability was the sign at onset in all patients and cerebellar signs were present in 5. Eight of these 15 individuals were sporadic.
In summary, the presence of HSP-TCC is the best single indicator that SPG11 should be tested in patients with onset in the first to third decade, but the presence of one or more other signs, such as mental retardation and later cognitive deterioration, lower motor neuron involvement and white matter lesions, increases the chance of identifying SPG11 mutations. Additionally, evidence of white matter abnormalities in the periventricular regions increases even further the probability that SPG11 is the cause of the disease, rather than other causes of leucodystrophy. HSP mainly affects the corticospinal axons by a dying back mechanism but lesions in SPG11 are wider, as suggested by the identification of TCC and other white matter abnormalities, signs of lower motor neuron degeneration, cerebellar ataxia and abnormal visual evoked potentials. Further studies are now required to understand the effects of these mutations, all truncating, causing the loss of spatacsin function in upper and lower motor neurons as well as in other regions of the nervous system.
| Supplementary materials |
|---|
|
|
|---|
Supplementary materials are available at Brain online.
| Appendix |
|---|
|
|
|---|
Members of the Spastic Paraplegia and ATAXia network (SPATAX): Dr A. Durr (Hôpital Pitié-Salpêtrière, Paris, France), Pr B. Fontaine (Hôpital Pitié-Salpêtrière, Paris, France), Pr J.P. Azulay (Hôpital de la Timone, Marseille, France), Pr A. Benomar (CHU, Rabat, Morocco), Pr E. Bertini (Osp. Bambino Gesù, Roma, Italy), Dr O. Boespflug-Tanguy (Faculté de Médecine, Clermont-Ferrand, France), Pr P. Coutinho (Hospital San Sebastião, Santa Maria da Feira, Portugal), Pr A. Filla (Università Degli Studi Di Napoli Federico II, Napoli, Italy), Pr D. Hannequin (Hôpital Charles Nicolle, Rouen, France), Dr A. Hamri (Hôpital Benbadis, Constantine, Algeria), Pr Michel Koenig (IGBMC, Illkirch, France), Pr P. Labauge (Hôpital Caremeau, Nimes, France), Pr A. Lossos (Hadassah Hebrew University Hospital, Jerusalem, Israel), Pr A. Megarbane (Université Saint-Joseph, Beirut, Lebanon), Pr J.E. Nielsen (The Panum Institute, Copenhagen, Denmark), Pr A.M. Ouvrard Hernandez (CHU, Grenoble, France), Dr E. Reid (Addenbrooke's Hospital, Cambridge, UK), Dr D. Rodriguez (Hôpital St Vincent De Paul, Paris, France) Pr S. Roumani (Dpt of Neurology, Damascus, Syria), Pr M. Salih (University Hospital, Ryadh, Saudi Arabia), Pr J. Sequeiros (University of Porto, Porto, Portugal), Dr C. Tallaksen (Ullevål University Hospital, Oslo, Norway), Pr M. Tazir (CHU Mustapha, Algiers, Algeria), Pr F. Tison (Groupe Hospitalier Sud, Pessac, France), Dr C. Goizet (Hôpital Pellegrin, Bordeaux, France), Dr E.M. Valente (Istituto Di Genetica Medica, Roma, Italy), Pr N. Wood (The National Hospital, London, UK), Dr C. Verny (CHU, Angers, France) and Pr T. Warner (Royal Free and University College Medical School, London, UK).
| Footnotes |
|---|
*The first three authors contributed equally to this work.
The members of the SPATAX consortium are listed in the Appendix. ![]()
| Acknowledgements |
|---|
The authors are grateful to the families and to the clinicians who referred patients to us, to Drs Samir Belal, Sebahattin Cirak, Michel Koenig, Clotilde Lagier-Tourenne and Merle Ruberg for their contribution in this study, to Drs Nizar Elleuch, Mohamed Imed Miladi, Catherine Lubetzki, Pilar Mazetti and Frederic Sedel for additional clinical investigations and to Nawal Benammar, Elodie Denis, Estelle Ferdiko and the DNA and cell bank of IFR70 for technical assistance. The study was funded by the Agence Nationale pour la Recherche (France, to A.D. and G.S.), the Verum foundation (Germany, to A.Br), the Hadassah France Fund for studies in spastic paraplegia (France, to A.L.) and the Groupement dIntérêt Scientifique – Institut des Maladies Rares (France, A04180DS/A04139DS to G.S.). P.D. and F.M.S. were supported by grants from Fondazione Mariani ONLUS and Telethon Italy (GGP06188).
| References |
|---|
|
|
|---|
Diagnosis and statistical Manual of Mental disorders. (2000) Washington DC: American Psychiatric Association.
Casali C, Valente EM, Bertini E, Montagna G, Criscuolo C, De Michele G, et al. Clinical and genetic studies in hereditary spastic paraplegia with thin corpus callosum. Neurology (2004) 62:262–8.
Casari G, De Fusco M, Ciarmatori S, Zeviani M, Mora M, Fernandez P, et al. Spastic paraplegia and OXPHOS impairment caused by mutations in paraplegin, a nuclear-encoded mitochondrial metalloprotease. Cell (1998) 93:973–83.[CrossRef][Web of Science][Medline]
Coutinho P, Barros J, Zemmouri R, Guimaraes J, Alves C, Chorao R, et al. Clinical heterogeneity of autosomal recessive spastic paraplegias: analysis of 106 patients in 46 families. Arch Neurol (1999) 56:943–9.
Del Bo R, Di Fonzo A, Ghezzi S, Locatelli F, Stevanin G, Costa A, et al. SPG11: a consistent clinical phenotype in a family with homozygous Spatacsin truncating mutation. Neurogenetics (2007) 8:301–5.[CrossRef][Web of Science][Medline]
Depienne C, Fedirko E, Forlani S, Cazeneuve C, Ribai P, Feki I, et al. Exon deletions of SPG4 are a frequent cause of hereditary spastic paraplegia. J Med Genet (2007) 44:281–4.
Depienne C, Tallaksen C, Lephay JY, Bricka B, Poea-Guyon S, Fontaine B, et al. Spastin mutations are frequent in sporadic spastic paraparesis and their spectrum is different from the one observed in familial cases. J Med Genet (2006) 43:259–65.
Elleuch N, Depienne C, Benomar A, Hernandez AM, Ferrer X, Fontaine B, et al. Mutation analysis of the paraplegin gene (SPG7) in patients with hereditary spastic paraplegia. Neurology (2006) 66:654–9.
Engert JC, Berube P, Mercier J, Dore C, Lepage P, Ge B, et al. ARSACS, a spastic ataxia common in northeastern Quebec, is caused by mutations in a new gene encoding an 11.5-kb ORF. Nat Genet (2000) 24:120–5.[CrossRef][Web of Science][Medline]
Filla A, De MG, Marconi R, Bucci L, Carillo C, Castellano AE, et al. Prevalence of hereditary ataxias and spastic paraplegias in Molise, a region of Italy. J Neurol (1992) 239:351–3.[CrossRef][Web of Science][Medline]
Fink JK. Advances in the hereditary spastic paraplegias. Exp Neurol (2003) 184 (Suppl 1):S106–10.[CrossRef]
Fink JK. Hereditary spastic paraplegia. Curr Neurol Neurosci Rep (2006) 6:65–76.[Web of Science][Medline]
Folstein MF, Folstein SE, McHugh PR. "Mini-mental state". A practical method for grading the cognitive state of patients for the clinician. J Psychiatr Res (1975) 12:189–98.[CrossRef][Web of Science][Medline]
Franca MC Jr., DAbreu A, Maurer-Morelli CV, Seccolin R, Appenzeller S, Alessio A, et al. Prospective neuroimaging study in hereditary spastic paraplegia with thin corpus callosum. Mov Disord (2007) 22:1556–62.[CrossRef][Web of Science][Medline]
Harding AE. Classification of the hereditary ataxias and paraplegias. Lancet (1983) 1:1151–5.[Web of Science][Medline]
Hazan J, Fonknechten N, Mavel D, Paternotte C, Samson D, Artiguenave F, et al. Spastin, a new AAA protein, is altered in the most frequent form of autosomal dominant spastic paraplegia. Nature Genet (1999) 23:296–303.[CrossRef][Web of Science][Medline]
Lossos A, Stevanin G, Meiner V, Argov Z, Bouslam N, Newman JP, et al. Hereditary spastic paraplegia with thin corpus callosum: reduction of the SPG11 interval and evidence for further genetic heterogeneity. Arch Neurol (2006) 63:756–60.
Mannan AU, Krawen P, Sauter SM, Boehm J, Chronowska A, Paulus W, et al. ZFYVE27 (SPG33), a novel spastin-binding protein, is mutated in hereditary spastic paraplegia. Am J Hum Genet (2006) 79:351–57.[CrossRef][Web of Science][Medline]
Martinez MF, Kobayashi H, Pegoraro E, Galluzzi G, Creel G, Mariani C, et al. Genetic localization of a new locus for recessive familial spastic paraparesis to 15q13-15. Neurology (1999) 53:50–6.
Olmez A, Uyanik G, Ozgul RK, Gross C, Cirak S, Elibol B, et al. Further Clinical and genetic characterization of SPG11: hereditary spastic paraplegia with thin corpus callosum. Neuropediatrics (2006) 37:59–66.[CrossRef][Web of Science][Medline]
Patel H, Cross H, Proukakis C, Hershberger R, Bork P, Ciccarelli FD, et al. SPG20 is mutated in Troyer syndrome, an hereditary spastic paraplegia. Nature Genet (2002) 31:347–8.[Web of Science][Medline]
Raven RC. Revised manual for Raven's Progressive Matrices and Vocabulary Scale (1982) UK: Windsor.
Shibasaki Y, Tanaka H, Iwabuchi K, Kawasaki S, Kondo H, Uekawa K, et al. Linkage of autosomal recessive hereditary spastic paraplegia with mental impairment and thin corpus callosum to chromosome 15q13-15. Ann Neurol (2000) 48:108–12.[CrossRef][Web of Science][Medline]
Simpson MA, Cross H, Proukakis C, Pryde A, Hershberger R, Chatonnet A, et al. Maspardin is mutated in mast syndrome, a complicated form of hereditary spastic paraplegia associated with dementia. Am J Hum Genet (2003) 73:1147–56.[CrossRef][Web of Science][Medline]
Stevanin G, Montagna G, Azzedine H, Valente EM, Durr A, Scarano V, et al. Spastic paraplegia with thin corpus callosum: description of 20 new families, refinement of the SPG11 locus, candidate gene analysis and evidence of genetic heterogeneity. Neurogenetics (2006) 7:149–56.[CrossRef][Web of Science][Medline]
Stevanin G, Santorelli FM, Azzedine H, Coutinho P, Chomilier J, Denora PS, et al. Mutations in SPG11, encoding spatacsin, are a major cause of spastic paraplegia with thin corpus callosum. Nature Genet (2007) 39:366–72.[CrossRef][Web of Science][Medline]
Tallaksen CM, Durr A, Brice A. Recent advances in hereditary spastic paraplegia. Curr Opin Neurol (2001) 14:457–63.[CrossRef][Web of Science][Medline]
Valdmanis PN, Meijer IA, Reynolds A, Lei A, MacLeod P, Schlesinger D, et al. Mutations in the KIAA0196 gene at the SPG8 locus cause hereditary spastic paraplegia. Am J Hum Genet (2007) 80:152–61.[CrossRef][Web of Science][Medline]
Wechsler D. Wechsler Memory Scale-Revised manual (1987) San Antonio, TX: The Psychological Corporation.
Winner B, Gross C, Uyanik G, Schulte-Mattler W, Lurding R, Marienhagen J, et al. Thin corpus callosum and amyotrophy in spastic paraplegia-Case report and review of literature. Clin Neurol Neurosurg (2006) 692–8.
Zhao X, Alvarado D, Rainier S, Lemons R, Hedera P, Weber CH, et al. Mutations in a newly identified GTPase gene cause autosomal dominant hereditary spastic paraplegia. Nature Genet (2001) 29:326–31.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
R Schule, N Schlipf, M Synofzik, S Klebe, S Klimpe, U Hehr, B Winner, T Lindig, A Dotzer, O Riess, et al. Frequency and phenotype of SPG11 and SPG15 in complicated hereditary spastic paraplegia J. Neurol. Neurosurg. Psychiatry, December 1, 2009; 80(12): 1402 - 1404. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Goizet, A. Boukhris, D. Maltete, L. Guyant-Marechal, J. Truchetto, E. Mundwiller, S. Hanein, P. Jonveaux, F. Roelens, J. Loureiro, et al. SPG15 is the second most common cause of hereditary spastic paraplegia with thin corpus callosum Neurology, October 6, 2009; 73(14): 1111 - 1119. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Erichsen, J. Koht, A. Stray-Pedersen, M. Abdelnoor, and C. M. E. Tallaksen Prevalence of hereditary ataxia and spastic paraplegia in southeast Norway: a population-based study Brain, June 1, 2009; 132(6): 1577 - 1588. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Goizet, A. Boukhris, A. Durr, C. Beetz, J. Truchetto, C. Tesson, M. Tsaousidou, S. Forlani, L. Guyant-Marechal, B. Fontaine, et al. CYP7B1 mutations in pure and complex forms of hereditary spastic paraplegia type 5 Brain, June 1, 2009; 132(6): 1589 - 1600. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Crimella, A Arnoldi, F Crippa, M L Mostacciuolo, F Boaretto, M Sironi, M G. D'Angelo, S Manzoni, L Piccinini, A C Turconi, et al. Point mutations and a large intragenic deletion in SPG11 in complicated spastic paraplegia without thin corpus callosum J. Med. Genet., May 1, 2009; 46(5): 345 - 351. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Boukhris, G. Stevanin, I. Feki, E. Denis, N. Elleuch, M. I. Miladi, J. Truchetto, P. Denora, S. Belal, C. Mhiri, et al. Hereditary Spastic Paraplegia With Mental Impairment and Thin Corpus Callosum in Tunisia: SPG11, SPG15, and Further Genetic Heterogeneity Arch Neurol, March 1, 2008; 65(3): 393 - 402. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








